Inherited Deficiency of Mannan-Binding LectinAssociated Serine Protease 2
Kristian Stengaard-Pedersen, M.D., D.M.Sc., Steffen Thiel, Ph.D., Mihaela Gadjeva, Ph.D., Mette Møller-Kristensen, M.Sc., Rikke Sørensen, B.Sc., Lise T. Jensen, Ph.D., Anders G. Sjöholm, M.D., D.M.Sc., Lars Fugger, M.D., D.M.Sc., and Jens C. Jensenius, D.Phil., D.M.Sc.
The complement system is part of the innate immune system andcontributes to the establishment of adaptive immune responses.1The mannan-binding lectin pathway of the complement system isactivated when mannan-binding lectin binds to carbohydrate structureson microorganisms.2 This happens through autoactivation of themannan-binding lectinassociated serine protease 2 (MASP-2),which then cleaves complement factors C4 and C2, generatingthe C3 convertase C4bC2b.3,4 Activation of C3 initiates thealternative pathway and the formation of the membrane-attackcomplex. Complement fragments deposited on microorganisms facilitatephagocytosis and initiate inflammatory reactions. Like mannan-bindinglectin, the recognition molecules L-ficolin and H-ficolin activatecomplement by a MASP-2dependent mechanism.5 Three otherproteins are associated with mannan-binding lectin and ficolins:mannan-binding lectinassociated proteases 1 and 3 (MASP-1and MASP-3), serine proteases of unknown function, and MAp19,a fragment of MASP-2, with four additional amino acid residues.6,7A deficiency of mannan-binding lectin is associated with susceptibilityto infections and with the development of immunologic disease.8We describe a patient with an inherited deficiency of MASP-2.
Case Report
A man who had been born in 1967 was essentially healthy until1980, when he received a diagnosis of ulcerative colitis. Thecondition was successfully treated with topical prednisolone.In 1996 erythema multiforme bullosum developed. Systemic lupuserythematosus was suspected because of joint symptoms and myalgiain combination with weakly positive tests for antinuclear antibody.The patient had a favorable response to treatment with prednisolone,and other immunosuppressive drugs were subsequently added tothe regimen.
Severe pneumococcal pneumonia was documented at least threetimes between 1995 and 1997, with one episode of sepsis requiringprolonged intensive care. In 1997, roentgenography and transbronchialbiopsy showed progressive lung fibrosis without vasculitis,alveolitis, or granulomas. Hypocomplementemia was found, buta Coomb's test and tests for antibodies against native DNA,cardiolipin, neutrophil cytoplasm, human immunodeficiency virus,and hepatitis A, B, and C virus were negative. Differentialleukocyte counts and tests of kidney and liver function werealso normal.
The patient's inflammatory disease persisted. Complement analysisin October 2002 showed severe hypocomplementemia with anti-C1qautoantibodies and low C1q levels (see Supplementary Appendix 1,available with the full text of this article at http://www.nejm.org).Immunosuppressive treatment is now limited to 5 to 15 mg ofprednisolone daily. Without this treatment, the patient's skinsymptoms worsen. The patient's parents, brother, and his twochildren have no increased susceptibility to infections.
Methods
Reagents and Samples
We used a monoclonal antibody raised against MAp19 and a monoclonalantibody that reacts only against MASP-2 alone, generated withthe use of the three C-terminal domains of MASP-2. Antibodyagainst MASP-1 was generated from clone 12F2.9 Rat antiMASP-3antiserum was generated with the use of recombinant MASP-3 B-chain.EDTA-treated plasma samples were obtained on three occasionsfrom the patient while his condition was clinically stable andfrom his parents, brother, and two children. Mannan-bindinglectindeficient serum (<20 ng of mannan-binding lectinper milliliter) was obtained from two healthy volunteers. Serumsamples from 17 patients who had hypocomplementemia with lowC1q levels (8 with systemic lupus erythematosus, 5 with hypocomplementemicurticarial vasculitis syndrome, and 4 with unexplained hypocomplementemia)were also analyzed. The studies were approved by the appropriateethics committees, and samples were obtained after each subjector the subject's parent had provided written informed consent.
Recombinant Proteins
MASP-2 complementary DNA was cloned in the pCI eukaryotic expressionvector (Promega), and recombinant MASP-2 was produced in a humanembryonic-kidney-cell line, HEK293, with use of the Free Style293-F system (GIBCO). Recombinant mutant MASP-2 was producedafter site-directed mutagenesis by an overlapping polymerasechain reaction (PCR). Recombinant mannan-binding lectin wasproduced as described previously.10
Complement Analysis
C3 and C4 were quantified by turbidometry. C1q, C1 inhibitor,properdin, C3d fragments, terminal component complexes (SC5bC9),the function of the classic and alternative pathways, and autoantibodiesto C1q were determined as described previously.11,12,13,14,15The function of C1 inhibitor was determined with the use ofa commercial kit (Behringwerke), and mannan-binding lectin bymeans of a time-resolved immunofluorometric assay.14 The functionof the mannan-binding lectin pathway was assessed on the basisof the capacity of the mannan-binding lectinMASP complexto induce the deposition of C4b onto a mannan-coated surface.16Levels of MASP-2 were measured with the use of a sandwich-typetime-resolved immunofluorometric assay on plates coated withantibody against MASP-2 and subsequent incubation with a biotinylatedantibody against MAp19MASP-2 and europium-labeled streptavidin.To identify MASPs bound to mannan-binding lectin with the useof Western blotting, we incubated plasma samples in microtiterwells coated with antibody against mannan-binding lectin. Theresulting bound material was eluted with sample buffer for sodiumdodecyl sulfatepolyacryl-amide-gel electrophoresis andanalyzed by Western blotting through incubation with antibodiesagainst MASP.17
Gene Sequencing
DNA was isolated from EDTA-treated blood. The exons of the geneencoding MAp19 and MASP-2 as well as 1100 bp of the promoterregion were amplified by PCR and sequenced (Lark). We subsequentlyused the primer sets 5'GCGAGTACGACTTCGTCAAGG3' and 5'CTCGGCTGCATAGAAGGCCTC3'to amplify parts of the region encoding the first domain (CUB1)and 5'CCAGACCTTTGGAAAGTTAGC3' and 5'GGCTCAAGTTCCAAGTATTGC3'to amplify part of the region encoding the fifth domain (thecomplement control protein domain 2) of MASP-2. These PCR productswere sequenced. The gene for mannan-binding lectin (MBL) wassequenced after the individual exons had been amplified by PCR.
Results
Analyses of the functional activity of the mannan-binding lectinMASPcomplex in the patient revealed severe deficiency, with lessthan 10 mU of mannan-binding lectin activity per microgram.The 5th to 95th percentile is 300 to 950 mU of mannan-bindinglectin per microgram.18 The patient was heterozygous for themannan-binding lectin B allotype, and his mannan-binding lectinlevel (0.7 µg per milliliter) was within the range reportedfor blood donors with this allotype.19 In other persons withthis allotype, the specific activity of the pathway is withinthe normal range.18
The mannan-binding lectinMASP complexes from the patientcontained MASP-1 (Figure 1B) and MASP-3 (Figure 1C) but no MAp19or MASP-2 (Figure 1A). This result was confirmed by Westernblot analysis of complexes eluted from wells coated with antibodyagainst mannan-binding lectin, whereas the same analyses showedall four components in mannan-binding lectinMASP complexesin plasma from control subjects (see Supplementary Appendix 2,available with the full text of this article at http://www.nejm.org).
Figure 1. Analyses of the Mannan-Binding Lectin (MBL) Pathway for Complexes of MAp19 and MBL-Associated Serine Protease 2 (MASP-2) (Panel A), MASP-1 (Panel B), MASP-3 (Panel C), C4b Deposition (Panel D), and C4 Deposition (Panel E), and the Plasma Volume of MASP-2 and MAp19 (Panel F).
Plasma from one control subject and the patient was diluted in hypertonic buffer and incubated in mannan-coated microtiter wells, and the bound complexes were analyzed with antibody against MAp19MASP-2 complex (Panel A), antibody against MASP-1 (Panel B), and antibody against MASP-3 (Panel C). Bound antibody was detected with anti-immunoglobulin antibody labeled with europium. Other plasma samples from control subjects were tested and yielded results similar to those shown for the control subject in Panels A, B, and C. Panel D shows the ability of recombinant MASP-2 (rMASP-2) to restore the activity of the MBL pathway in the patient. Culture supernatant from an rMASP-2 cell culture or from a control cell culture was added to a serum sample from the patient. The serum was then incubated in mannan-coated wells, allowing MBLMASP complexes to bind and C4b to be deposited in the wells. The amount of C4 deposited was estimated with the use of an antibody against C4. Panel E shows the lack of effect of adding recombinant MBL to plasma from the patient as compared with plasma from a subject with MBL deficiency, after incubation in mannan-coated wells and washing. C4 was added and the deposition of C4b was measured. With regard to plasma from the patient, the MBL values are the sum of endogenous and added MBL. Panel F shows the quantification of MASP-2 and MAp19 in plasma. Plasma from a control subject (lanes 1 through 6) and the patient (lanes 7 through 11) at several dilutions was incubated with beads coated with antibody against MAp19MASP-2, and bound material was eluted and analyzed with the use of Western blotting.
Analysis for MASP-2 and MAp19 that were not bound to mannan-bindinglectin in plasma was carried out with the use of affinity purificationon beads coated with antibody against MAp19MASP-2 andWestern blotting. The results showed the presence of trace amountsof MASP-2 (less than 10 percent of that in normal serum), whereasthe amount of MAp19 was about 50 percent of the normal level(Figure 1F). The mannan-binding lectin pathway in the patientwas restored by reconstitution with recombinant MASP-2 (Figure 1D)or mannan-binding lectindeficient plasma (data notshown). This demonstrated that mannan-binding lectin from thepatient was fully active. Accordingly, the addition of recombinantmannan-binding lectin to plasma from a subject with mannan-bindinglectin deficiency restored the mannan-binding lectin pathway,whereas it had no effect when added to the patient's plasma(Figure 1E). The activity of the mannan-binding lectin pathwayin plasma from the patient's mother (300 mU of mannan-bindinglectin per microgram), his two children (200 and 220 mU permicrogram), and a brother (233 mU per microgram) was at or belowthe 5th percentile. The activity could not be directly evaluatedin plasma from the patient's father owing to the low level ofmannan-binding lectin. However, on the addition of recombinantmannan-binding lectin, the activity was increased to one thirdof the activity in two reference samples of mannan-binding lectindeficientserum.
The patient had low levels of C1q, C4, and C3; increased levelsof C3dg; and anti-C1q antibodies (see Supplementary Appendix1). These findings prompted studies in other patients with evidenceof pronounced activation of the classic pathway. Eleven of the17 patients studied had anti-C1q autoantibodies. No patienthad reduced activity of the mannan-binding lectin pathway. Autoantibodyagainst MASP-2 did not appear to be the cause of the MASP-2deficiency in our patient, since antibodies against MASP-2 couldnot be detected on Western blotting of mannan-binding lectinMASPpreparations, in microtiter wells coated with mannan-bindinglectinMASP complex, or bound to mannan-binding lectinMASPcomplex in plasma.
The promoter region and all the exons encoding MASP-2MAp19were sequenced and compared with known sequences. GenBank presentstwo different codons for the amino acid at position 371 in thefirst part of complement control protein 2: a GAT encoding asparticacid and a TAT encoding tyrosine. The patient and all his familymembers were homozygous for TAT. Of 15 unrelated control subjects,10 were homozygous for TAT, 3 were heterozygous (TAT/GAT), and2 were homozygous for GAT. Hence, these variants represent commonallotypes of no discernible consequence with respect to thefunction of MASP-2.
Another difference in the patient's sequence was in exon 3 inthe codon for the amino acid at position 120 (position 105 inthe mature protein) that is, in the CUB1 domain where codon GGC was found instead of GAC. The patient was homozygousfor this variant, which resulted in the substitution of glycinefor aspartic acid (Figure 2). Amplification by PCR and sequencingof the region around the mutation in CUB1 demonstrated thatthe patient's parents, brother, and two children were heterozygous(GAC/GGC). Of 100 control subjects, 89 were homozygous for GACand 11 were heterozygous (GAC/GGC), yielding a gene frequencyof 0.055 for the mutant allotype. Heterozygotes had significantlylower MASP-2 levels (by 45 percent) than those who were homozygousfor the wild-type MASP-2 (Figure 3). The patient's MASP-2 levelwas about 5 percent of the levels in these homozygous subjects.
Figure 2. The Structure of Mannan-Binding LectinAssociated Serine Protease 2 (MASP-2) and MAp19 (Panel A), and the Location of the Mutation in MASP-2 (Panels B and C).
In Panel A, the position of the mutation in the CUB1 domain is indicated by a solid circle. E denotes the EGF-like domain; CCP1 and CCP2 complement control protein domains 1 and 2, respectively; and SP the serine protease domain. Panel B shows the nucleotide and amino acid sequences flanking the mutation in CUB1 (amino acid 105 in the mature protein). Panel C shows the position of the mutated amino acid (solid circle) in the crystal structure of the homologous CUB domain of sperm adhesin.20
Figure 3. Mannan-Binding LectinAssociated Serine Protease 2 (MASP-2) Levels in Plasma from 86 Control Subjects Who Were Homozygous for the Wild Type (D120/D120), 11 Heterozygous (D120/G120) Control Subjects and the 5 Heterozygous Members of the Patient's Family, and the Patient, Who Was Homozygous for the Mutant Sequence (G120/G120).
The levels of MASP-2 were estimated by means of a double-antibody assay. Standard curves were constructed with the use of a pool of normal plasma arbitrarily assigned the value of 1 U of MASP-2 per milliliter. The mean levels (horizontal lines), the 10th and 90th percentiles (I bars), and outliers (open circles) are shown. P<0.001 for the difference in MASP-2 values between the patient and the other two groups.
To determine the importance of the substitution in the CUB1domain, we examined recombinant wild-type and mutant MASP-2in functional assays. Mutant MASP-2 could not associate withmannan-binding lectin (Figure 4A) and thus could not form anactive mannan-binding lectinMASP complex (Figure 4B).Western blotting showed that the size of the mutated recombinantMASP-2 was identical to that of the wild type, and no degradationfragments were observed (Figure 4C).
Figure 4. Functional Analysis of Recombinant Wild-Type and Mutant Mannan-Binding LectinAssociated Serine Protease 2 (MASP-2) with Respect to Their Binding to Mannan-Binding Lectin (MBL) (Panel A), C4-Cleaving Capacity (Panel B), and Size (Panel C).
A mixture of MBL and wild-type MASP-2 or mutated MASP-2 was incubated in anti-MBLcoated microtiter wells. Bound MASP-2 was detected with the use of antiMASP-2 antibody (Panel A). The ability of bound MASP-2 to cleave C4 was assessed by incubation in bound MASP-2 with C4 followed by anti-C4 antibody (Panel B). Panel C shows a Western blot of the two recombinant MASPs.
Discussion
In our patient with a history of infections and chronic inflammatorydisease, the mannan-binding lectin pathway was nonfunctionaldespite the presence of a normal level of immunoreactive mannan-bindinglectin. This malfunction was caused by the absence of MASP-2in the mannan-binding lectinMASP complex. The activityof the mannan-binding lectinMASP complex was restoredby the addition of recombinant MASP-2. The mannan-binding lectinMASPcomplex contained no MASP-2 but a normal level of MASP-1 andan elevated level of MASP-3, results that are consistent withour previous finding that MASP-3 competes with MASP-2 for bindingto mannan-binding lectin.6 The mannan-binding lectinMASPcomplex also contained no MAp19. MASP-2 and MAp19 could be detectedin plasma at low levels.
The gene encoding MASP-2 had a mutation in the CUB1 domain,causing substitution of glycine for aspartic acid in the loopconnecting beta strands 8 and 9 (i.e., D120G) (Figure 2).20The change from an acidic to a neutral amino acid may have profoundeffects on the function of the domain. The aspartic acid atthis position is conserved in all MASPs as well as in the similarserine proteases C1r and C1s of the classic complement pathway.The CUB1epidermal growth factor domains are essentialfor the association of MAp19 and MASP-2 with mannan-bindinglectin.21,22 Analysis of the recombinant wild-type and mutatedMASP-2 showed that the mutation prevents the formation of functionalmannan-binding lectinMASP-2 complexes.
The patient's parents, brother, and two children had a low levelof activity of the mannan-binding lectin pathway, and they wereall heterozygous for the CUB1 mutation. Likewise, the levelof MASP-2 in control subjects who were heterozygous for theCUB1 mutation was about half of that in subjects with the wildtype, suggesting a dominant effect of an autosomally inheritedmutant allotype. Recombinant wild-type and mutant MASP-2 weresecreted at similar levels by transfected cells, indicatingthat the mutation had no effect on intracellular processing.The failure of the mutant MASP-2 to bind to mannan-binding lectinmay enhance its catabolism. MASP-2 forms dimers,21,22 whichin heterozygous persons may be a mixture of wild-type and mutatedMASP-2 and therefore may be more susceptible to degradation.It is not clear why the level of MAp19 was less strongly affectedthan the level of MASP-2.
The frequency of the gene containing the CUB1 mutation was determinedto be 0.055. One would expect about 0.3 percent of the populationto be homozygous for the mutation, making MASP-2 deficiencya fairly common complement deficiency. Complement deficienciesare usually associated with susceptibility to invasive infectionscaused by encapsulated bacteria or with the development of immunologicdiseases such as systemic lupus erythematosus.1 Mannan-bindinglectin deficiency has been described as a factor in susceptibilityto infections and may also contribute to the development ofimmunologic disease.8 The consequences of MASP-2 deficiencymight be more severe, since MASP-2 also mediates the activationof complement through the ficolins.5
It seems likely that the MASP-2 deficiency was at least partlyresponsible for the manifestations of disease in our patient,even though the clinical findings in a single patient must beinterpreted with caution. The absence of serious infectionsduring childhood is consistent with the findings in some patientswho have a deficiency of C4 or C2.23 An impairment in the functionof the mannan-binding lectin pathway predisposes patients toinvasive pneumococcal disease,24 supporting the assumption thatour patient's severe pneumococcal infections were due to a MASP-2deficiency. The patient's hypocomplementemia may also have contributedto his impaired immune defense. Low C1q levels and the presenceof anti-C1q autoantibodies are characteristics of hypocomplementemicurticarial vasculitis syndrome15,25 and severe systemic lupuserythematosus.26 These diagnoses were not justified in our patient,and we found normal MASP-2 levels in patients with hypocomplementemicurticarial vasculitis syndrome and systemic lupus erythematosus.Identification of the prevalence of the CUB1 mutation shouldfacilitate the determination of its clinical effect on immunedefense and the development of inflammatory disease.
Supported by grants from the Danish Medical Research Council,the Karen Elise Jensens Foundation, King Gustaf V's 80th BirthdayFund, and the Novo Nordisk Foundation.
We are indebted to Drs. Gerard Arlaud and Nicole Thielens, Grenoble,France, for donating the recombinant MAp19, MASP-3 B chain,and MASP-2 C-terminal fragment.
Source Information
From the Departments of Rheumatology (K.S.-P.) and Clinical Immunology (L.T.J., L.F.), Aarhus University Hospital; and the Department of Medical Microbiology and Immunology, University of Aarhus (S.T., M.G., M.M.-K., R.S., J.C.J.) both in Aarhus, Denmark; Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, United Kingdom (L.F.); and the Institute of Laboratory Medicine, Section of Microbiology, Immunology, and Glycobiology, University of Lund, Lund, Sweden (A.G.S.). Drs. Fugger and Jensenius contributed equally to this article.
Address reprint requests to Dr. Thiel at the Department of Medical Microbiology and Immunology, University of Aarhus, 8000 Aarhus, Denmark, or at st{at}microbiology.au.dk.
References
Walport MJ. Complement. N Engl J Med 2001;344:1058-66, 1140. [Free Full Text]
Gadjeva M, Thiel S, Jensenius JC. The mannan-binding-lectin pathway of the innate immune response. Curr Opin Immunol 2001;13:74-78. [CrossRef][Web of Science][Medline]
Thiel S, Vorup-Jensen T, Stover CM, et al. A second serine protease associated with mannan-binding lectin that activates complement. Nature 1997;386:506-510. [CrossRef][Medline]
Vorup-Jensen T, Petersen SV, Hansen AG, et al. Distinct pathways of mannan-binding lectin (MBL)- and C1-complex autoactivation revealed by reconstitution of MBL with recombinant MBL-associated serine protease-2. J Immunol 2000;165:2093-2100. [Free Full Text]
Dahl MR, Thiel S, Matsushita M, et al. MASP-3 and its association with distinct complexes of the mannan-binding lectin complement activation pathway. Immunity 2001;15:127-135. [CrossRef][Web of Science][Medline]
Stover CM, Thiel S, Thelen M, et al. Two constituents of the initiation complex of the mannan-binding lectin activation pathway of complement are encoded by a single structural gene. J Immunol 1999;162:3481-3490. [Free Full Text]
Jack DL, Klein NJ, Turner MW. Mannose-binding lectin: targeting the microbial world for complement attack and opsonophagocytosis. Immunol Rev 2001;180:86-99. [CrossRef][Web of Science][Medline]
Petersen SV. Purification and characterization of mannan-binding lectin (MBL) associated serine protease-1. (Ph.D. thesis. Aarhus, Denmark: University of Aarhus, 2001.)
Vorup-Jensen T, Sorensen ES, Jensen UB, et al. Recombinant expression of human mannan-binding lectin. Int Immunopharmacol 2001;1:677-87.
Johnson U, Truedsson L, Gustavii B. Complement components in 100 newborns and their mothers determined by electroimmunoassay. Acta Pathol Microbiol Immunol Scand (C) 1983;91:147-50.
Brandslund I, Siersted HC, Svehag S-E, Teisner B. Double-decker rocket immunoelectrophoresis for direct quantitation of complement C3 split products with C3d specificities in plasma. J Immunol Methods 1981;44:63-71. [CrossRef][Medline]
Mollnes TE. Analysis of in vivo complement activation. In: Weir DM, Herzenberg LA, Blackwell C, eds. Weir's handbook of experimental immunology. 5th ed. Boston: Blackwell Science, 1996:71-8.
Sjöholm AG, Truedsson L, Jensenius JC. Complement pathways and meningococcal disease: diagnostic aspects. In: Pollard AJ, Maiden MCJ, eds. Meningococcal disease: methods and protocols. Totowa, N.J.: Humana Press, 2001:529-47.
Mårtensson U, Sjöholm AG, Sturfelt G, Truedsson L, Laurell AB. Western blot analysis of human IgG reactive with the collagenous portion of C1q: evidence of distinct binding specificities. Scand J Immunol 1992;35:735-744. [CrossRef][Web of Science][Medline]
Petersen SV, Thiel S, Jensen L, Steffensen R, Jensenius JC. An assay for the mannan-binding lectin pathway of complement activation. J Immunol Methods 2001;257:107-116. [CrossRef][Web of Science][Medline]
Thiel S, Petersen SV, Vorup-Jensen T, et al. Interaction of C1q and mannan-binding lectin (MBL) with C1r, C1s, MBL-associated serine proteases 1 and 2, and the MBL-associated protein MAp19. J Immunol 2000;165:878-887. [Free Full Text]
Thiel S, Møller-Kristensen M, Jensen L, Jensenius JC. Assays for the functional activity of the mannan-binding lectin pathway of complement activation. Immunobiology 2002;205:446-454. [CrossRef][Web of Science][Medline]
Steffensen R, Thiel S, Varming K, Jersild C, Jensenius JC. Detection of structural gene mutations and promoter polymorphisms in the mannan-binding lectin (MBL) gene by polymerase chain reaction with sequence-specific primers. J Immunol Methods 2000;241:33-42. [CrossRef][Web of Science][Medline]
Romao MJ, Kolln I, Dias JM, et al. Crystal structure of acidic seminal fluid protein (aSFP) at 1.9 A resolution: a bovine polypeptide of the spermadhesin family. J Mol Biol 1997;274:650-660. [CrossRef][Web of Science][Medline]
Thielens NM, Cseh S, Thiel S, et al. Interaction properties of human mannan-binding lectin (MBL)-associated serine proteases-1 and -2, MBL-associated protein 19, and MBL. J Immunol 2001;166:5068-5077. [Free Full Text]
Chen CB, Wallis R. Stoichiometry of complexes between mannose-binding protein and its associated serine proteases: defining functional units for complement activation. J Biol Chem 2001;276:25894-25902. [Free Full Text]
Figueroa JE, Densen P. Infectious diseases associated with complement deficiencies. Clin Microbiol Rev 1991;4:359-395. [Free Full Text]
Roy S, Knox K, Segal S, et al. MBL genotype and risk of invasive pneumococcal disease: a case-control study. Lancet 2002;359:1569-1573. [CrossRef][Web of Science][Medline]
Wisnieski JJ, Baer AN, Christensen J, et al. Hypocomplementemic urticarial vasculitis syndrome: clinical and serologic findings in 18 patients. Medicine (Baltimore) 1995;74:24-41. [CrossRef][Medline]
Sjöholm AG, Mårtensson U, Sturfelt G. Serial analysis of autoantibody responses to the collagen-like region of C1q, collagen type II, and double-stranded DNA in patients with systemic lupus erythematosus. J Rheumatol 1997;24:871-878. [Web of Science][Medline]
Munthe-Fog, L., Hummelshoj, T., Honore, C., Madsen, H. O., Permin, H., Garred, P.
(2009). Immunodeficiency Associated with FCN3 Mutation and Ficolin-3 Deficiency. NEJM
360: 2637-2644
[Abstract][Full Text]
Thiel, S., Kolev, M., Degn, S., Steffensen, R., Hansen, A. G., Ruseva, M., Jensenius, J. C.
(2009). Polymorphisms in Mannan-Binding Lectin (MBL)-Associated Serine Protease 2 Affect Stability, Binding to MBL, and Enzymatic Activity. J. Immunol.
182: 2939-2947
[Abstract][Full Text]
Sagedal, S., Thiel, S., Hansen, T. K., Mollnes, T. E., Rollag, H., Hartmann, A.
(2008). Impact of the complement lectin pathway on cytomegalovirus disease early after kidney transplantation. Nephrol Dial Transplant
23: 4054-4060
[Abstract][Full Text]
Teillet, F., Gaboriaud, C., Lacroix, M., Martin, L., Arlaud, G. J., Thielens, N. M.
(2008). Crystal Structure of the CUB1-EGF-CUB2 Domain of Human MASP-1/3 and Identification of Its Interaction Sites with Mannan-binding Lectin and Ficolins. J. Biol. Chem.
283: 25715-25724
[Abstract][Full Text]
Ramasawmy, R., Spina, G. S., Fae, K. C., Pereira, A. C., Nisihara, R., Messias Reason, I. J., Grinberg, M., Tarasoutchi, F., Kalil, J., Guilherme, L.
(2008). Association of Mannose-Binding Lectin Gene Polymorphism but Not of Mannose-Binding Serine Protease 2 with Chronic Severe Aortic Regurgitation of Rheumatic Etiology. CVI
15: 932-936
[Abstract][Full Text]
Blanc, G., Font, B., Eichenberger, D., Moreau, C., Ricard-Blum, S., Hulmes, D. J. S., Moali, C.
(2007). Insights into How CUB Domains Can Exert Specific Functions while Sharing a Common Fold: CONSERVED AND SPECIFIC FEATURES OF THE CUB1 DOMAIN CONTRIBUTE TO THE MOLECULAR BASIS OF PROCOLLAGEN C-PROTEINASE ENHANCER-1 ACTIVITY. J. Biol. Chem.
282: 16924-16933
[Abstract][Full Text]
Carneiro-Sampaio, M., Coutinho, A.
(2007). Immunity to Microbes: Lessons from Primary Immunodeficiencies. Infect. Immun.
75: 1545-1555
[Full Text]
Smithson, A., Munoz, A., Suarez, B., Soto, S. M., Perello, R., Soriano, A., Martinez, J. A., Vila, J., Horcajada, J. P., Mensa, J., Lozano, F.
(2007). Association between Mannose-Binding Lectin Deficiency and Septic Shock following Acute Pyelonephritis Due to Escherichia coli. CVI
14: 256-261
[Abstract][Full Text]
Richard, I
(2005). The genetic and molecular bases of monogenic disorders affecting proteolytic systems. J. Med. Genet.
42: 529-539
[Abstract][Full Text]
Ytting, H., Jarle Christensen, I., Thiel, S., Jensenius, J. C., Nielsen, H. J.
(2005). Serum Mannan-Binding Lectin-Associated Serine Protease 2 Levels in Colorectal Cancer: Relation to Recurrence and Mortality. Clin. Cancer Res.
11: 1441-1446
[Abstract][Full Text]
Seelen, M. A., van der Bijl, E. A., Trouw, L. A., Zuiverloon, T. C. M., Munoz, J. R., Fallaux-van den Houten, F. C., Schlagwein, N., Daha, M. R., Huizinga, T. W. J., Roos, A.
(2005). A role for mannose-binding lectin dysfunction in generation of autoantibodies in systemic lupus erythematosus. Rheumatology (Oxford)
44: 111-119
[Abstract][Full Text]
Gregory, L. A., Thielens, N. M., Matsushita, M., Sorensen, R., Arlaud, G. J., Fontecilla-Camps, J. C., Gaboriaud, C.
(2004). The X-ray Structure of Human Mannan-binding Lectin-associated Protein 19 (MAp19) and Its Interaction Site with Mannan-binding Lectin and L-ficolin. J. Biol. Chem.
279: 29391-29397
[Abstract][Full Text]
Casanova, J.-L., Abel, L.
(2004). Human Mannose-binding Lectin in Immunity: Friend, Foe, or Both?. JEM
199: 1295-1299
[Abstract][Full Text]