The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
Brief Report
PreviousPrevious
Volume 349:554-560 August 7, 2003 Number 6
NextNext

Inherited Deficiency of Mannan-Binding Lectin–Associated Serine Protease 2
Kristian Stengaard-Pedersen, M.D., D.M.Sc., Steffen Thiel, Ph.D., Mihaela Gadjeva, Ph.D., Mette Møller-Kristensen, M.Sc., Rikke Sørensen, B.Sc., Lise T. Jensen, Ph.D., Anders G. Sjöholm, M.D., D.M.Sc., Lars Fugger, M.D., D.M.Sc., and Jens C. Jensenius, D.Phil., D.M.Sc.

 

This Article
- PDF
-PDA Full Text
-Supplementary Material

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited
-E-mail When Letters Appear

More Information
-PubMed Citation
The complement system is part of the innate immune system and contributes to the establishment of adaptive immune responses.1 The mannan-binding lectin pathway of the complement system is activated when mannan-binding lectin binds to carbohydrate structures on microorganisms.2 This happens through autoactivation of the mannan-binding lectin–associated serine protease 2 (MASP-2), which then cleaves complement factors C4 and C2, generating the C3 convertase C4bC2b.3,4 Activation of C3 initiates the alternative pathway and the formation of the membrane-attack complex. Complement fragments deposited on microorganisms facilitate phagocytosis and initiate inflammatory reactions. Like mannan-binding lectin, the recognition molecules L-ficolin and H-ficolin activate complement by a MASP-2–dependent mechanism.5 Three other proteins are associated with mannan-binding lectin and ficolins: mannan-binding lectin–associated proteases 1 and 3 (MASP-1 and MASP-3), serine proteases of unknown function, and MAp19, a fragment of MASP-2, with four additional amino acid residues.6,7 A deficiency of mannan-binding lectin is associated with susceptibility to infections and with the development of immunologic disease.8 We describe a patient with an inherited deficiency of MASP-2.

Case Report

A man who had been born in 1967 was essentially healthy until 1980, when he received a diagnosis of ulcerative colitis. The condition was successfully treated with topical prednisolone. In 1996 erythema multiforme bullosum developed. Systemic lupus erythematosus was suspected because of joint symptoms and myalgia in combination with weakly positive tests for antinuclear antibody. The patient had a favorable response to treatment with prednisolone, and other immunosuppressive drugs were subsequently added to the regimen.

Severe pneumococcal pneumonia was documented at least three times between 1995 and 1997, with one episode of sepsis requiring prolonged intensive care. In 1997, roentgenography and transbronchial biopsy showed progressive lung fibrosis without vasculitis, alveolitis, or granulomas. Hypocomplementemia was found, but a Coomb's test and tests for antibodies against native DNA, cardiolipin, neutrophil cytoplasm, human immunodeficiency virus, and hepatitis A, B, and C virus were negative. Differential leukocyte counts and tests of kidney and liver function were also normal.

The patient's inflammatory disease persisted. Complement analysis in October 2002 showed severe hypocomplementemia with anti-C1q autoantibodies and low C1q levels (see Supplementary Appendix 1, available with the full text of this article at http://www.nejm.org). Immunosuppressive treatment is now limited to 5 to 15 mg of prednisolone daily. Without this treatment, the patient's skin symptoms worsen. The patient's parents, brother, and his two children have no increased susceptibility to infections.

Methods

Reagents and Samples

We used a monoclonal antibody raised against MAp19 and a monoclonal antibody that reacts only against MASP-2 alone, generated with the use of the three C-terminal domains of MASP-2. Antibody against MASP-1 was generated from clone 12F2.9 Rat anti–MASP-3 antiserum was generated with the use of recombinant MASP-3 B-chain. EDTA-treated plasma samples were obtained on three occasions from the patient while his condition was clinically stable and from his parents, brother, and two children. Mannan-binding lectin–deficient serum (<20 ng of mannan-binding lectin per milliliter) was obtained from two healthy volunteers. Serum samples from 17 patients who had hypocomplementemia with low C1q levels (8 with systemic lupus erythematosus, 5 with hypocomplementemic urticarial vasculitis syndrome, and 4 with unexplained hypocomplementemia) were also analyzed. The studies were approved by the appropriate ethics committees, and samples were obtained after each subject or the subject's parent had provided written informed consent.

Recombinant Proteins

MASP-2 complementary DNA was cloned in the pCI eukaryotic expression vector (Promega), and recombinant MASP-2 was produced in a human embryonic-kidney-cell line, HEK293, with use of the Free Style 293-F system (GIBCO). Recombinant mutant MASP-2 was produced after site-directed mutagenesis by an overlapping polymerase chain reaction (PCR). Recombinant mannan-binding lectin was produced as described previously.10

Complement Analysis

C3 and C4 were quantified by turbidometry. C1q, C1 inhibitor, properdin, C3d fragments, terminal component complexes (SC5b–C9), the function of the classic and alternative pathways, and autoantibodies to C1q were determined as described previously.11,12,13,14,15 The function of C1 inhibitor was determined with the use of a commercial kit (Behringwerke), and mannan-binding lectin by means of a time-resolved immunofluorometric assay.14 The function of the mannan-binding lectin pathway was assessed on the basis of the capacity of the mannan-binding lectin–MASP complex to induce the deposition of C4b onto a mannan-coated surface.16 Levels of MASP-2 were measured with the use of a sandwich-type time-resolved immunofluorometric assay on plates coated with antibody against MASP-2 and subsequent incubation with a biotinylated antibody against MAp19–MASP-2 and europium-labeled streptavidin. To identify MASPs bound to mannan-binding lectin with the use of Western blotting, we incubated plasma samples in microtiter wells coated with antibody against mannan-binding lectin. The resulting bound material was eluted with sample buffer for sodium dodecyl sulfate–polyacryl-amide-gel electrophoresis and analyzed by Western blotting through incubation with antibodies against MASP.17

Gene Sequencing

DNA was isolated from EDTA-treated blood. The exons of the gene encoding MAp19 and MASP-2 as well as 1100 bp of the promoter region were amplified by PCR and sequenced (Lark). We subsequently used the primer sets 5'GCGAGTACGACTTCGTCAAGG3' and 5'CTCGGCTGCATAGAAGGCCTC3' to amplify parts of the region encoding the first domain (CUB1) and 5'CCAGACCTTTGGAAAGTTAGC3' and 5'GGCTCAAGTTCCAAGTATTGC3' to amplify part of the region encoding the fifth domain (the complement control protein domain 2) of MASP-2. These PCR products were sequenced. The gene for mannan-binding lectin (MBL) was sequenced after the individual exons had been amplified by PCR.

Results

Analyses of the functional activity of the mannan-binding lectin–MASP complex in the patient revealed severe deficiency, with less than 10 mU of mannan-binding lectin activity per microgram. The 5th to 95th percentile is 300 to 950 mU of mannan-binding lectin per microgram.18 The patient was heterozygous for the mannan-binding lectin B allotype, and his mannan-binding lectin level (0.7 µg per milliliter) was within the range reported for blood donors with this allotype.19 In other persons with this allotype, the specific activity of the pathway is within the normal range.18

The mannan-binding lectin–MASP complexes from the patient contained MASP-1 (Figure 1B) and MASP-3 (Figure 1C) but no MAp19 or MASP-2 (Figure 1A). This result was confirmed by Western blot analysis of complexes eluted from wells coated with antibody against mannan-binding lectin, whereas the same analyses showed all four components in mannan-binding lectin–MASP complexes in plasma from control subjects (see Supplementary Appendix 2, available with the full text of this article at http://www.nejm.org).


View larger version (29K):
[in this window]
[in a new window]
 
Figure 1. Analyses of the Mannan-Binding Lectin (MBL) Pathway for Complexes of MAp19 and MBL-Associated Serine Protease 2 (MASP-2) (Panel A), MASP-1 (Panel B), MASP-3 (Panel C), C4b Deposition (Panel D), and C4 Deposition (Panel E), and the Plasma Volume of MASP-2 and MAp19 (Panel F).

Plasma from one control subject and the patient was diluted in hypertonic buffer and incubated in mannan-coated microtiter wells, and the bound complexes were analyzed with antibody against MAp19–MASP-2 complex (Panel A), antibody against MASP-1 (Panel B), and antibody against MASP-3 (Panel C). Bound antibody was detected with anti-immunoglobulin antibody labeled with europium. Other plasma samples from control subjects were tested and yielded results similar to those shown for the control subject in Panels A, B, and C. Panel D shows the ability of recombinant MASP-2 (rMASP-2) to restore the activity of the MBL pathway in the patient. Culture supernatant from an rMASP-2 cell culture or from a control cell culture was added to a serum sample from the patient. The serum was then incubated in mannan-coated wells, allowing MBL–MASP complexes to bind and C4b to be deposited in the wells. The amount of C4 deposited was estimated with the use of an antibody against C4. Panel E shows the lack of effect of adding recombinant MBL to plasma from the patient as compared with plasma from a subject with MBL deficiency, after incubation in mannan-coated wells and washing. C4 was added and the deposition of C4b was measured. With regard to plasma from the patient, the MBL values are the sum of endogenous and added MBL. Panel F shows the quantification of MASP-2 and MAp19 in plasma. Plasma from a control subject (lanes 1 through 6) and the patient (lanes 7 through 11) at several dilutions was incubated with beads coated with antibody against MAp19–MASP-2, and bound material was eluted and analyzed with the use of Western blotting.

 
Analysis for MASP-2 and MAp19 that were not bound to mannan-binding lectin in plasma was carried out with the use of affinity purification on beads coated with antibody against MAp19–MASP-2 and Western blotting. The results showed the presence of trace amounts of MASP-2 (less than 10 percent of that in normal serum), whereas the amount of MAp19 was about 50 percent of the normal level (Figure 1F). The mannan-binding lectin pathway in the patient was restored by reconstitution with recombinant MASP-2 (Figure 1D) or mannan-binding lectin–deficient plasma (data not shown). This demonstrated that mannan-binding lectin from the patient was fully active. Accordingly, the addition of recombinant mannan-binding lectin to plasma from a subject with mannan-binding lectin deficiency restored the mannan-binding lectin pathway, whereas it had no effect when added to the patient's plasma (Figure 1E). The activity of the mannan-binding lectin pathway in plasma from the patient's mother (300 mU of mannan-binding lectin per microgram), his two children (200 and 220 mU per microgram), and a brother (233 mU per microgram) was at or below the 5th percentile. The activity could not be directly evaluated in plasma from the patient's father owing to the low level of mannan-binding lectin. However, on the addition of recombinant mannan-binding lectin, the activity was increased to one third of the activity in two reference samples of mannan-binding lectin–deficient serum.

The patient had low levels of C1q, C4, and C3; increased levels of C3dg; and anti-C1q antibodies (see Supplementary Appendix 1). These findings prompted studies in other patients with evidence of pronounced activation of the classic pathway. Eleven of the 17 patients studied had anti-C1q autoantibodies. No patient had reduced activity of the mannan-binding lectin pathway. Autoantibody against MASP-2 did not appear to be the cause of the MASP-2 deficiency in our patient, since antibodies against MASP-2 could not be detected on Western blotting of mannan-binding lectin–MASP preparations, in microtiter wells coated with mannan-binding lectin–MASP complex, or bound to mannan-binding lectin–MASP complex in plasma.

The promoter region and all the exons encoding MASP-2–MAp19 were sequenced and compared with known sequences. GenBank presents two different codons for the amino acid at position 371 in the first part of complement control protein 2: a GAT encoding aspartic acid and a TAT encoding tyrosine. The patient and all his family members were homozygous for TAT. Of 15 unrelated control subjects, 10 were homozygous for TAT, 3 were heterozygous (TAT/GAT), and 2 were homozygous for GAT. Hence, these variants represent common allotypes of no discernible consequence with respect to the function of MASP-2.

Another difference in the patient's sequence was in exon 3 in the codon for the amino acid at position 120 (position 105 in the mature protein) — that is, in the CUB1 domain — where codon GGC was found instead of GAC. The patient was homozygous for this variant, which resulted in the substitution of glycine for aspartic acid (Figure 2). Amplification by PCR and sequencing of the region around the mutation in CUB1 demonstrated that the patient's parents, brother, and two children were heterozygous (GAC/GGC). Of 100 control subjects, 89 were homozygous for GAC and 11 were heterozygous (GAC/GGC), yielding a gene frequency of 0.055 for the mutant allotype. Heterozygotes had significantly lower MASP-2 levels (by 45 percent) than those who were homozygous for the wild-type MASP-2 (Figure 3). The patient's MASP-2 level was about 5 percent of the levels in these homozygous subjects.


View larger version (19K):
[in this window]
[in a new window]
 
Figure 2. The Structure of Mannan-Binding Lectin–Associated Serine Protease 2 (MASP-2) and MAp19 (Panel A), and the Location of the Mutation in MASP-2 (Panels B and C).

In Panel A, the position of the mutation in the CUB1 domain is indicated by a solid circle. E denotes the EGF-like domain; CCP1 and CCP2 complement control protein domains 1 and 2, respectively; and SP the serine protease domain. Panel B shows the nucleotide and amino acid sequences flanking the mutation in CUB1 (amino acid 105 in the mature protein). Panel C shows the position of the mutated amino acid (solid circle) in the crystal structure of the homologous CUB domain of sperm adhesin.20

 

View larger version (5K):
[in this window]
[in a new window]
 
Figure 3. Mannan-Binding Lectin–Associated Serine Protease 2 (MASP-2) Levels in Plasma from 86 Control Subjects Who Were Homozygous for the Wild Type (D120/D120), 11 Heterozygous (D120/G120) Control Subjects and the 5 Heterozygous Members of the Patient's Family, and the Patient, Who Was Homozygous for the Mutant Sequence (G120/G120).

The levels of MASP-2 were estimated by means of a double-antibody assay. Standard curves were constructed with the use of a pool of normal plasma arbitrarily assigned the value of 1 U of MASP-2 per milliliter. The mean levels (horizontal lines), the 10th and 90th percentiles (I bars), and outliers (open circles) are shown. P<0.001 for the difference in MASP-2 values between the patient and the other two groups.

 
To determine the importance of the substitution in the CUB1 domain, we examined recombinant wild-type and mutant MASP-2 in functional assays. Mutant MASP-2 could not associate with mannan-binding lectin (Figure 4A) and thus could not form an active mannan-binding lectin–MASP complex (Figure 4B). Western blotting showed that the size of the mutated recombinant MASP-2 was identical to that of the wild type, and no degradation fragments were observed (Figure 4C).


View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. Functional Analysis of Recombinant Wild-Type and Mutant Mannan-Binding Lectin–Associated Serine Protease 2 (MASP-2) with Respect to Their Binding to Mannan-Binding Lectin (MBL) (Panel A), C4-Cleaving Capacity (Panel B), and Size (Panel C).

A mixture of MBL and wild-type MASP-2 or mutated MASP-2 was incubated in anti-MBL–coated microtiter wells. Bound MASP-2 was detected with the use of anti–MASP-2 antibody (Panel A). The ability of bound MASP-2 to cleave C4 was assessed by incubation in bound MASP-2 with C4 followed by anti-C4 antibody (Panel B). Panel C shows a Western blot of the two recombinant MASPs.

 
Discussion

In our patient with a history of infections and chronic inflammatory disease, the mannan-binding lectin pathway was nonfunctional despite the presence of a normal level of immunoreactive mannan-binding lectin. This malfunction was caused by the absence of MASP-2 in the mannan-binding lectin–MASP complex. The activity of the mannan-binding lectin–MASP complex was restored by the addition of recombinant MASP-2. The mannan-binding lectin–MASP complex contained no MASP-2 but a normal level of MASP-1 and an elevated level of MASP-3, results that are consistent with our previous finding that MASP-3 competes with MASP-2 for binding to mannan-binding lectin.6 The mannan-binding lectin–MASP complex also contained no MAp19. MASP-2 and MAp19 could be detected in plasma at low levels.

The gene encoding MASP-2 had a mutation in the CUB1 domain, causing substitution of glycine for aspartic acid in the loop connecting beta strands 8 and 9 (i.e., D120G) (Figure 2).20 The change from an acidic to a neutral amino acid may have profound effects on the function of the domain. The aspartic acid at this position is conserved in all MASPs as well as in the similar serine proteases C1r and C1s of the classic complement pathway. The CUB1–epidermal growth factor domains are essential for the association of MAp19 and MASP-2 with mannan-binding lectin.21,22 Analysis of the recombinant wild-type and mutated MASP-2 showed that the mutation prevents the formation of functional mannan-binding lectin–MASP-2 complexes.

The patient's parents, brother, and two children had a low level of activity of the mannan-binding lectin pathway, and they were all heterozygous for the CUB1 mutation. Likewise, the level of MASP-2 in control subjects who were heterozygous for the CUB1 mutation was about half of that in subjects with the wild type, suggesting a dominant effect of an autosomally inherited mutant allotype. Recombinant wild-type and mutant MASP-2 were secreted at similar levels by transfected cells, indicating that the mutation had no effect on intracellular processing. The failure of the mutant MASP-2 to bind to mannan-binding lectin may enhance its catabolism. MASP-2 forms dimers,21,22 which in heterozygous persons may be a mixture of wild-type and mutated MASP-2 and therefore may be more susceptible to degradation. It is not clear why the level of MAp19 was less strongly affected than the level of MASP-2.

The frequency of the gene containing the CUB1 mutation was determined to be 0.055. One would expect about 0.3 percent of the population to be homozygous for the mutation, making MASP-2 deficiency a fairly common complement deficiency. Complement deficiencies are usually associated with susceptibility to invasive infections caused by encapsulated bacteria or with the development of immunologic diseases such as systemic lupus erythematosus.1 Mannan-binding lectin deficiency has been described as a factor in susceptibility to infections and may also contribute to the development of immunologic disease.8 The consequences of MASP-2 deficiency might be more severe, since MASP-2 also mediates the activation of complement through the ficolins.5

It seems likely that the MASP-2 deficiency was at least partly responsible for the manifestations of disease in our patient, even though the clinical findings in a single patient must be interpreted with caution. The absence of serious infections during childhood is consistent with the findings in some patients who have a deficiency of C4 or C2.23 An impairment in the function of the mannan-binding lectin pathway predisposes patients to invasive pneumococcal disease,24 supporting the assumption that our patient's severe pneumococcal infections were due to a MASP-2 deficiency. The patient's hypocomplementemia may also have contributed to his impaired immune defense. Low C1q levels and the presence of anti-C1q autoantibodies are characteristics of hypocomplementemic urticarial vasculitis syndrome15,25 and severe systemic lupus erythematosus.26 These diagnoses were not justified in our patient, and we found normal MASP-2 levels in patients with hypocomplementemic urticarial vasculitis syndrome and systemic lupus erythematosus. Identification of the prevalence of the CUB1 mutation should facilitate the determination of its clinical effect on immune defense and the development of inflammatory disease.

Supported by grants from the Danish Medical Research Council, the Karen Elise Jensens Foundation, King Gustaf V's 80th Birthday Fund, and the Novo Nordisk Foundation.

We are indebted to Drs. Gerard Arlaud and Nicole Thielens, Grenoble, France, for donating the recombinant MAp19, MASP-3 B chain, and MASP-2 C-terminal fragment.


Source Information

From the Departments of Rheumatology (K.S.-P.) and Clinical Immunology (L.T.J., L.F.), Aarhus University Hospital; and the Department of Medical Microbiology and Immunology, University of Aarhus (S.T., M.G., M.M.-K., R.S., J.C.J.) — both in Aarhus, Denmark; Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, United Kingdom (L.F.); and the Institute of Laboratory Medicine, Section of Microbiology, Immunology, and Glycobiology, University of Lund, Lund, Sweden (A.G.S.).

Drs. Fugger and Jensenius contributed equally to this article.

Address reprint requests to Dr. Thiel at the Department of Medical Microbiology and Immunology, University of Aarhus, 8000 Aarhus, Denmark, or at st{at}microbiology.au.dk.

References

  1. Walport MJ. Complement. N Engl J Med 2001;344:1058-66, 1140. [Free Full Text]
  2. Gadjeva M, Thiel S, Jensenius JC. The mannan-binding-lectin pathway of the innate immune response. Curr Opin Immunol 2001;13:74-78. [CrossRef][Web of Science][Medline]
  3. Thiel S, Vorup-Jensen T, Stover CM, et al. A second serine protease associated with mannan-binding lectin that activates complement. Nature 1997;386:506-510. [CrossRef][Medline]
  4. Vorup-Jensen T, Petersen SV, Hansen AG, et al. Distinct pathways of mannan-binding lectin (MBL)- and C1-complex autoactivation revealed by reconstitution of MBL with recombinant MBL-associated serine protease-2. J Immunol 2000;165:2093-2100. [Free Full Text]
  5. Matsushita M, Fujita T. Ficolins and the lectin complement pathway. Immunol Rev 2001;180:78-85. [CrossRef][Web of Science][Medline]
  6. Dahl MR, Thiel S, Matsushita M, et al. MASP-3 and its association with distinct complexes of the mannan-binding lectin complement activation pathway. Immunity 2001;15:127-135. [CrossRef][Web of Science][Medline]
  7. Stover CM, Thiel S, Thelen M, et al. Two constituents of the initiation complex of the mannan-binding lectin activation pathway of complement are encoded by a single structural gene. J Immunol 1999;162:3481-3490. [Free Full Text]
  8. Jack DL, Klein NJ, Turner MW. Mannose-binding lectin: targeting the microbial world for complement attack and opsonophagocytosis. Immunol Rev 2001;180:86-99. [CrossRef][Web of Science][Medline]
  9. Petersen SV. Purification and characterization of mannan-binding lectin (MBL) associated serine protease-1. (Ph.D. thesis. Aarhus, Denmark: University of Aarhus, 2001.)
  10. Vorup-Jensen T, Sorensen ES, Jensen UB, et al. Recombinant expression of human mannan-binding lectin. Int Immunopharmacol 2001;1:677-87.
  11. Johnson U, Truedsson L, Gustavii B. Complement components in 100 newborns and their mothers determined by electroimmunoassay. Acta Pathol Microbiol Immunol Scand (C) 1983;91:147-50.
  12. Brandslund I, Siersted HC, Svehag S-E, Teisner B. Double-decker rocket immunoelectrophoresis for direct quantitation of complement C3 split products with C3d specificities in plasma. J Immunol Methods 1981;44:63-71. [CrossRef][Medline]
  13. Mollnes TE. Analysis of in vivo complement activation. In: Weir DM, Herzenberg LA, Blackwell C, eds. Weir's handbook of experimental immunology. 5th ed. Boston: Blackwell Science, 1996:71-8.
  14. Sjöholm AG, Truedsson L, Jensenius JC. Complement pathways and meningococcal disease: diagnostic aspects. In: Pollard AJ, Maiden MCJ, eds. Meningococcal disease: methods and protocols. Totowa, N.J.: Humana Press, 2001:529-47.
  15. Mårtensson U, Sjöholm AG, Sturfelt G, Truedsson L, Laurell AB. Western blot analysis of human IgG reactive with the collagenous portion of C1q: evidence of distinct binding specificities. Scand J Immunol 1992;35:735-744. [CrossRef][Web of Science][Medline]
  16. Petersen SV, Thiel S, Jensen L, Steffensen R, Jensenius JC. An assay for the mannan-binding lectin pathway of complement activation. J Immunol Methods 2001;257:107-116. [CrossRef][Web of Science][Medline]
  17. Thiel S, Petersen SV, Vorup-Jensen T, et al. Interaction of C1q and mannan-binding lectin (MBL) with C1r, C1s, MBL-associated serine proteases 1 and 2, and the MBL-associated protein MAp19. J Immunol 2000;165:878-887. [Free Full Text]
  18. Thiel S, Møller-Kristensen M, Jensen L, Jensenius JC. Assays for the functional activity of the mannan-binding lectin pathway of complement activation. Immunobiology 2002;205:446-454. [CrossRef][Web of Science][Medline]
  19. Steffensen R, Thiel S, Varming K, Jersild C, Jensenius JC. Detection of structural gene mutations and promoter polymorphisms in the mannan-binding lectin (MBL) gene by polymerase chain reaction with sequence-specific primers. J Immunol Methods 2000;241:33-42. [CrossRef][Web of Science][Medline]
  20. Romao MJ, Kolln I, Dias JM, et al. Crystal structure of acidic seminal fluid protein (aSFP) at 1.9 A resolution: a bovine polypeptide of the spermadhesin family. J Mol Biol 1997;274:650-660. [CrossRef][Web of Science][Medline]
  21. Thielens NM, Cseh S, Thiel S, et al. Interaction properties of human mannan-binding lectin (MBL)-associated serine proteases-1 and -2, MBL-associated protein 19, and MBL. J Immunol 2001;166:5068-5077. [Free Full Text]
  22. Chen CB, Wallis R. Stoichiometry of complexes between mannose-binding protein and its associated serine proteases: defining functional units for complement activation. J Biol Chem 2001;276:25894-25902. [Free Full Text]
  23. Figueroa JE, Densen P. Infectious diseases associated with complement deficiencies. Clin Microbiol Rev 1991;4:359-395. [Free Full Text]
  24. Roy S, Knox K, Segal S, et al. MBL genotype and risk of invasive pneumococcal disease: a case-control study. Lancet 2002;359:1569-1573. [CrossRef][Web of Science][Medline]
  25. Wisnieski JJ, Baer AN, Christensen J, et al. Hypocomplementemic urticarial vasculitis syndrome: clinical and serologic findings in 18 patients. Medicine (Baltimore) 1995;74:24-41. [CrossRef][Medline]
  26. Sjöholm AG, Mårtensson U, Sturfelt G. Serial analysis of autoantibody responses to the collagen-like region of C1q, collagen type II, and double-stranded DNA in patients with systemic lupus erythematosus. J Rheumatol 1997;24:871-878. [Web of Science][Medline]

 

This Article
- PDF
-PDA Full Text
-Supplementary Material

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited
-E-mail When Letters Appear

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.