Background Recent outbreaks of avian influenza A (H5N1) in poultrythroughout Asia have had major economic and health repercussions.Human infections with this virus were identified in Vietnamin January 2004.
Methods We report the clinical features and preliminary epidemiologicfindings among 10 patients with confirmed cases of avian influenzaA (H5N1) who presented to hospitals in Ho Chi Minh City andHanoi, Vietnam, in December 2003 and January 2004.
Results In all 10 cases, the diagnosis of influenza A (H5N1)was confirmed by means of viral culture or reverse transcriptasepolymerasechain reaction with primers specific for H5 and N1. None ofthe 10 patients (mean age, 13.7 years) had preexisting medicalconditions. Nine of them had a clear history of direct contactwith poultry (median time before onset of illness, three days).All patients presented with fever (temperature, 38.5 to 40.0°C),respiratory symptoms, and clinically significant lymphopenia(median lymphocyte count, 700 per cubic millimeter). The medianplatelet count was 75,500 per cubic millimeter. Seven patientshad diarrhea. In all patients, there were marked abnormalitieson chest radiography. There was no definitive evidence of human-to-humantransmission. Eight patients died, one patient has recovered,and one is recovering.
Conclusions Influenza A (H5N1) infection, characterized by fever,respiratory symptoms, and lymphopenia, carries a high risk ofdeath. Although in all 10 cases the infection appears to havebeen acquired directly from infected poultry, the potentialexists for genetic reassortment with human influenzavirusesand the evolution of human-to-human transmission. Containmentof influenza A (H5N1) in poultry throughout Asia is thereforeurgently required.
Influenza A virus infects a variety of animals, including humansand birds.1 Although the natural reservoir for all known subtypesof influenza A (hemagglutinins H1 through H15 and neuraminidasesN1 through N9) is wild waterfowl, only three subtypes are currentlycirculating among humans (H1N1, H1N2, and H3N2). However, duringthe past few years, several subtypes of avian influenza A havebeen shown to cross the species barrier and infect humans. Duringan outbreak of a highly pathogenic influenza A (H5N1) virusamong poultry in Hong Kong in 1997, 6 of 18 people with confirmedinfection died.2 After this outbreak, prevention policies andearly detection strategies were put into place, and no new casesof H5N1 were detected in Hong Kong until February 2003, whentwo cases were reported, one of which resulted in death.1 Possiblyas a result of heightened surveillance, avian influenza A (H9N2)viruses were also isolated from children in Hong Kong in 1999,but this infection resulted in only mild, self-limiting illnesses.3,4
A total of 89 human infections with influenza A (H7N7), including1 resulting in the death of a Dutch veterinarian, occurred duringthe extensive outbreak in 2003 that decimated the Dutch poultryindustry.5,6 During late 2003 and early 2004, there were reportsof large outbreaks of H5N1 among poultry throughout Asia (includingSouth Korea, Japan, Indonesia, Vietnam, Thailand, Laos, Cambodia,and China). In January 2004, there was confirmation that influenzaA (H5N1) virus had been isolated from patients who had diedof a respiratory illness in Hanoi and Ho Chi Minh City, Vietnam.We report the epidemiologic, clinical, and radiographic featuresin 10 patients with confirmed influenza A (H5N1) infection.
Methods
Patients
We identified 10 patients in Vietnam with avian influenza A(H5N1) virus infection as confirmed by culture or reverse-transcriptasepolymerase chain reaction (RT-PCR). Four of the patients (Patients1, 2, 3, and 4) were admitted to the National Hospital for Pediatricsin Hanoi between December 27, 2003, and January 14, 2004. Theother six patients (Patients 5, 6, 7, 8, 9, and 10) were admittedto the Hospital for Tropical Diseases in Ho Chi Minh City betweenJanuary 20 and January 30, 2004. Epidemiologic data were collectedthrough interviews of the patients and their relatives. Dataon vital signs, physical findings, and routine laboratory testswere obtained by means of a retrospective review of the hospitalrecords (for Patients 1, 2, 3, and 4) and from prospectivelyrecorded case notes (for Patients 5, 6, 7, 8, 9, and 10).
Radiologic Assessment
Chest radiographs were obtained in all patients during hospitalizationand were reviewed by experienced clinicians. The radiologicfindings were categorized with attention to unilateral or bilateralchanges; focal, lobar, or patchy consolidation; air-space infiltrates;air bronchograms; pleural effusions; and volume loss with orwithout shift.
Microbiologic Evaluation
Blood cultures were obtained from all patients on admissionto the hospital. Throat and nasal swabs and, when appropriate,tracheal aspirates were collected in viral transport medium(Minimum Essential Medium Eagle with Hanks' salts, supplementedwith 0.5 percent gelatin and antibiotics [Sigma-Aldrich]) orphosphate-buffered saline and stored at 80°C. Inthe four patients in Hanoi, swabs were obtained and stored ina collection and transport system for viruses and chlamydiae(Multi-Microbe Medium Collection and Transport System [M4RT],Remel). Virus was cultured in monolayers of MadinDarbycanine kidney cells. Isolated virus was identified by meansof immunofluorescence and hemagglutination-inhibition assays,as previously described.1 Rapid influenza tests (Capillia FluA/B Test [Nippon Becton Dickinson] or QuickVue [Quidel]) wereused according to the manufacturers' instructions to test noseand throat swabs from six patients.
RNA Extraction and RT-PCR
RNA was extracted from 140 µl of nasal and throat swabsamples in phosphate-buffered saline or viral transport mediumwith the use of a viral RNA kit (QIAamp, Qiagen) and a doubleelution with 2x 40 µl of buffer; 5 µl of the RNAextract was analyzed in the RT-PCR assay. Reverse-transcriptasereactions contained 2 µl of 5x first-strand buffer, 2.5µM random hexamer primers (Roche Diagnostics), 40 unitsof RNase inhibitor (RNase OUT, Invitrogen), and 1 µl (200units) of reverse transcriptase (Superscript II, Invitrogen).Reverse-transcriptase reactions were performed at room temperaturefor 10 minutes, then at 42°C for 30 minutes and at 70°Cfor 5 minutes; 2 µl of the cDNA was used for amplificationin the PCR assays. The reactions (total volume of 25 µl)contained 2.5 µl of 10x PCR Gold buffer, 2.5 mM magnesiumchloride, 0.4 mM deoxynucleoside triphosphates (Roche Diagnostics),0.8 mM of each of the two primers, and 0.5 unit of AmpliTaqGold DNA polymerase (Applied Biosystems).
The samples from Patients 1, 2, 3, and 4 were tested with theprimer set for the H5 gene (forward primer H5-1: GCCATTCCACAACATACACCC;reverse primer H5-2: TAAATTCTCTATCCTCCTTTCCAA) with an expectedproduct size of 358 bp,2 and the primer set for the N1 gene(forward primer N1-1: TTGCTTGGTCAGCAAGTGCA; reverse primer N1-2:TCTGTCCATCCATTAGGATCC) with an expected product size of 615bp.7 Thermal cycling for these reactions was performed underthe following conditions: 94°C for 3 minutes; 40 cyclesof 94°C for 30 seconds, 45°C (for H5) or 55°C (forN1) for 30 seconds, and 72°C for 1 minute; then 72°Cfor 7 minutes.
The samples from Patients 5, 6, 7, 8, 9, and 10 were testedwith two different primer sets that are specific for the influenzaA subtype H5 gene: primer pair H5-1 and H5-2 (as described above)and primer pair H5b (forward primer H5/515: CATACCCAACAATAAAGAGG;and reverse primer H5/1220: GTGTTCATTTTGTTAATGAT, with an expectedproduct size of 708 bp). For samples from these six patients,the influenza A N1 gene was amplified with the primers describedabove, except that there was a modification in the N1-1 primer:TTGCTTGGTCAGCAAGTGCT. All patients were tested for the H1 subtypeof influenza A (with the forward primer H1: AGCAAAAGCAGGGGAAAATAAand the reverse primer H1: GCTATTTCTGGGGTGAATCT; expected sizeof the PCR product, 729 bp) and the H3 subtype of influenzaA (with the forward primer H3: AGCAAAAGCAGGGGATAATTC and thereverse primer H3: TGCCTGAAACCGTACCAACC; expected product size,1143 bp).
Thermal cycling for all amplifications, except for that of theinfluenza A N1 gene fragment, was 95°C for 10 minutes (preamplificationhot start); 10 cycles of 95°C for 30 seconds, 55°C for30 seconds (decreased by 1°C per cycle), and 72°C for1 minute; and 40 cycles of 95°C for 30 seconds, 45°Cfor 30 seconds, and 72°C for 1 minute. For the N1 gene fragment,thermal cycling conditions were 95°C for 10 minutes; 10cycles of 95°C for 30 seconds, 60°C for 30 seconds (decreasedby 1°C per cycle), and 72°C for 1 minute; and 40 cyclesof 95°C for 30 seconds, 55°C for 30 seconds, and 72°Cfor 1 minute.
Products were analyzed on a 2 percent agarose gel. Precautionsfor the avoidance of cross-contamination were strictly observed.All samples were obtained and transported in individual sealedbags. The preparation of RT-PCR mixtures, nucleic acid extractions,and amplification and analysis of PCR products were performedin three separate laboratories. Aerosol-resistant filter tips(A.R.T., Molecular BioProducts) were used throughout all laboratoryprocedures. Negative controls were included during the RNA extraction,reverse transcription, and PCR amplification.
Results
Patients and Contact History
The mean age of patients (four of whom were female and six male)was 13.7 years (range, 5 to 24); none had any known, clinicallysignificant preexisting medical conditions. Patients 8, 9, and10 were smokers. The patients were from both rural and urbanparts of Vietnam (Figure 1). Seven of the patients were childrenattending school. Patients 8, 9, and 10 came from the same districtin Lam Dong Province, were from the K'hor ethnic group, andworked as subsistence farmers. There was no contact among thepatients before hospitalization.
Figure 1. Map of Vietnam Showing the Reported Cases of Avian Influenza A (H5N1).
For eight of the nine patients in whom a history could be obtained,there was clear evidence of either direct handling of poultry(chickens or ducks) or exposure to sick poultry in the weekbefore the onset of illness (Table 1). The median time betweenexposure and the onset of illness was 3 days (range, 2 to 4)and the median time between the onset of illness and hospitalizationwas 5.9 days (range, 3 to 8). None of the patients had beeninvolved in the organized culling of poultry.
There were similar illnesses reported in relatives of Patients1 and 2. Patient 1 became sick on December 25, 2003, was admittedto the hospital on December 27, and died on December 30. Hermother became sick on January 1, 2004, was admitted to the hospitalon January 5, and died on January 9. Influenza A (H5N1) infectionwas confirmed in the mother (who is not included in this report).There was no illness reported in the father or sibling of Patient1. The seven-year-old sister of Patient 2 reportedly died ofa respiratory illness on the day Patient 2 was admitted to thehospital, but no clinical details are available. There was noillness reported in the parents or two other siblings of Patient2. No illness during the preceding two weeks or during hospitalizationwas reported in any family member or contacts of the other patients.
Infection-control measures were initiated in both hospitalsas soon as it was suspected that this illness was caused byinfluenza A (H5N1). No negative-pressure isolation facilitieswere available. Patients 1 and 2 were admitted before influenzaA (H5N1) was suspected, and therefore their cases were managedwith universal precautions but without additional infection-controlmeasures.
Clinical and Other Features
The clinical features of the patients with confirmed infectionwith influenza A (H5N1) virus are summarized in Table 2. Allpatients presented with fever, shortness of breath, and a cough;in five patients, there was a history of sputum production,and in three of these patients, the sputum was blood-stained.Two patients reported pleuritic pain. Diarrhea was reportedin seven of the patients. Bleeding from the nose and gums wasnoted in one patient on the fourth day of illness. No patienthad a sore throat, conjunctivitis, rash, or a runny nose. Physicalexamination in nine patients revealed fever, rapid respiratoryrate (median, 55 breaths per minute; range, 28 to 70), respiratorydistress, and crackles on examination of the chest.
Table 2. Clinical Characteristics of the Patients on Admission.
Laboratory Assessment
The results of the basic laboratory tests performed on admissionare shown in Table 3. The median total leukocyte count on admissionwas 2100 per cubic millimeter (range, 1200 to 3400). The mediantotal lymphocyte count was 700 per cubic millimeter (range,250 to 1100). The median ratio of CD4-positive cells to CD8-positivecells (measured in Patients 5, 7, 8, 9, and 10) was 0.70 (range,0.59 to 1.08). The median platelet count was 75,500 per cubicmillimeter (range, 45,000 to 174,000). Measurements of alanineaminotransferase and aspartate aminotransferase levels on admissionwere available in six patients and were elevated in five ofthem (Patients 1, 4, 5, 6, and 10); one patient (Patient 10)had an elevated serum creatinine concentration on admission.Three patients (Patients 7, 8, and 9) had marked hyperglycemiathat developed during hospitalization.
Blood cultures were all negative. Staphylococcus aureus wasisolated from a tracheal aspirate from Patient 1, and Haemophilusinfluenzae from a tracheal aspirate from Patient 2. The diagnosisof influenza A (H5N1) was confirmed through the isolation ofthe virus from postmortem lung tissue from Patient 1 and throatswabs from Patient 2. In all other patients, the diagnosis wasmade by means of RT-PCR with the use of primers specific toH5 and N1 in samples obtained from nasal and throat swabs. Amongthe patients hospitalized in Ho Chi Minh City, the results onRT-PCR with the use of the H5b (H5/515F and H5/1220R) primerpair were positive in all six patients tested (Figure 2), whereasthe results of RT-PCR with the H5-1 and H5-2 primer pair werepositive in four of the six patients tested. None of the patients'samples were positive with the use of primers specific for influenzaH1 or influenza H3. The median duration of illness at the timewhen RT-PCR confirmed the presence of avian influenza A (H5N1)was 6 days (range, 5 to 12).
Figure 2. RT-PCR Specific for the H5 Gene of Influenza A (H5N1) Virus, Performed with the Use of the H5b Primers (Panel A), and RT-PCR Specific for the N1 Gene, Performed with the Use of the Modified N1 Primers (Panel B).
Nasal or throat swabs from Patients 5, 6, 7, 8, 9, and 10 were used, as well as an H5 RNA control (A/HK/213/2003 [H5N1]), an H1 RNA control (A/New Caledonia/20/99 [IVR-116; H1N1]), and an H3 RNA control (A/Panama/2007/99 [N1B-41; H3N2]), all cultured in embryonated chicken eggs, and a negative control (RNA-extraction control), W1 (water control for reverse transcriptase), and W2 (water control for PCR).
Influenza A antigens were detected in two of the six patientswho were tested. In one patient (Patient 2), virus was isolatedfrom a sample obtained on day 7 of illness but could not beisolated from a sample obtained on day 15.
Radiologic Assessment
All chest radiographs were abnormal on admission to the hospital(Figure 3). The major abnormalities included extensive infiltrationbilaterally, lobar collapse, focal consolidation, and air bronchograms.No pleural effusions were noted. All patients had dramatic worseningof findings on chest radiography during hospitalization. Pneumothoraxdeveloped in Patients 2 and 4 while they were receiving mechanicalventilation.
Radiographs from Patient 5 (Panel A), Patient 7 (Panel B), and Patient 9 (Panel C) show widespread consolidation, collapse, and interstitial shadowing. In Panels D, E, and F, three chest radiographs show the progression in Patient 8 on days 5, 7, and 10 of illness, respectively.
Treatment and Outcome
All patients were treated empirically with broad-spectrum antibioticson admission. Patients 1, 2, 3, and 4 received 5 mg of methylprednisoloneper kilogram of body weight per day, and Patients 5, 7, and8 received 1 to 2 mg of methylprednisolone per kilogram fourtimes a day for one, three, and four days, respectively. Fivepatients were treated with the neuraminidase inhibitor oseltamivir(35 mg twice daily in Patient 5 and 75 mg twice daily in Patients7, 8, 9, and 10) for up to five days. Ribavirin was given toPatient 3 (800 mg three times a day) and Patient 4 (400 mg threetimes a day). The antiviral treatment was started on day 5 ofillness in Patients 4, 7, 9, and 10; day 6 in Patients 6 and8; day 11 in Patient 3; and day 12 in Patient 5. Patients 5,6, 7, 8, 9, and 10 received ranitidine.
Patient 5 required continuous positive airway pressure withsupplemental oxygen for the first seven days after admissionbut was subsequently weaned from this support and given maintenancetherapy with 40 percent oxygen. Patients 1, 2, 3, 4, 6, 7, 8,and 9 required mechanical ventilation during the first 48 hoursafter admission. In all these patients, there was a dramaticdeterioration of gas exchange despite pressure-controlled ventilation,high end-expiratory pressures, and a fraction of inspired oxygenof 1.0. Patients 7 and 8 were also treated with dopamine andnorepinephrine for hypotension. Patient 7 had a small gastrointestinalhemorrhage on the third day of hospitalization. Patients 7 and8 had marked hyperglycemia requiring insulin treatment to normalizethe blood glucose levels.
Despite a prolonged, severe illness, Patient 5 survived withno major sequelae. Eight other patients died, and one patientis recovering, for a case fatality rate of 80 percent amongpatients in our series. The median time to death from the onsetof illness was 9 days (range, 6 to 17). Neither during the periodwhen these patients were hospitalized nor subsequently was anyillness reported in a health care worker or laboratory staffmember.
Discussion
To date, there have been 20 confirmed cases of human infectionwith influenza A (H5N1) in Vietnam and Thailand; 16 of the infectedpatients have died. We describe the clinical features of 10cases of confirmed avian influenza A (H5N1) in patients admittedto referral hospitals in Vietnam.
The prominent clinical features on admission were those of asevere influenza syndrome with fever, cough, diarrhea, and shortnessof breath. The estimated time between the exposure to poultryand the onset of illness suggests an incubation period of twoto four days. Diarrhea was present in 7 of the 10 cases. Themost striking laboratory findings were marked lymphopenia andthrombocytopenia with a pronounced inversion of the CD4:CD8ratio in the five patients in whom it could be measured. A recoveryof the lymphocyte count and CD4:CD8 ratio was observed onlyin the two patients who survived. Liver and renal dysfunctionor impaired glycemic control was prominent in six of the patients.The patients were all children or young adults.
These clinical presentations were similar to those in the 1997outbreak of influenza A (H5N1) in Hong Kong, although diarrheawas a more prominent feature in the Vietnamese patients. Inaddition, the oldest patient in this series was 24 years old,whereas one patient was 54 years old and one was 60 years oldin the 1997 outbreak in Hong Kong.2 However, the mortality inour series was significantly higher than that in the 1997 outbreak.
Eight of the nine patients from whom a clear history could betaken reported close contact with poultry during the week beforethe onset of illness. A retrospective study after the Hong Kongoutbreak showed that visiting poultry markets before the onsetof illness was the only significant risk factor.8 The contactin six of the current cases involved direct handling of chickensor ducks (holding, killing, or defeathering them or preparingthem to be eaten) within the patient's home environment or smallhomesteads nearby, where a relatively small number of chickenswere kept. This finding suggests that direct contact is theprimary route of bird-to-human transmission. None of the patientswere involved in the organized culling of poultry or workedon large poultry farms. This observation, if confirmed, mayhave important implications for our understanding of the transmissionof this virus and potential immunity to it.
The available information on the two family clusters is compatiblewith bird-to-human transmission from a common source, but thereis currently not enough information to rule out limited human-to-humantransmission within the family. There was no illness reportedin family members of the other eight patients, even though otherfamily members seemed to have had very similar exposure to poultry for example, the brother of Patient 5 and the fathersof Patients 7 and 8. There is evidence from the 1997 outbreakin Hong Kong that the avian influenza A (H5N1) virus may havebeen transmitted from human to human but that transmission couldnot be sustained among humans.9,10 The absence of any reportto date of a similar illness among the health care workers whocared for these patients, despite the lack of full droplet andrespiratory infection-control measures early in the outbreak,is reassuring. We cannot rule out the possibility of mild orsubclinical infection in persons exposed to either ill poultryor ill persons. Detailed seroepidemiologic studies of the individualfamily members, health care workers, and others at risk wouldbe necessary in order to assess whether and to what extent human-to-humantransmission has occurred.
Oseltamivir was administered to five of the patients, four ofwhom died. Treatment with the drug may have been started toolate to be effective, although one of the two surviving patientsdid not start oseltamivir therapy until the 12th day of illness.At that point, she was still antigen-positive and PCR-positivefor the virus. There seemed to be no benefit from the oral administrationof ribavirin (in Patients 3 and 4). In vitro sensitivity testingof a limited number of strains of influenza A (H5N1) virus isolatedfrom patients in Vietnam have shown that they are resistantto amantadine and rimantadine, so these drugs should not berecommended for treatment. Six of the seven patients who weretreated with corticosteroids died. This experience is inadequateto permit the establishment of treatment recommendations withrespect to corticosteroids; more aggressive treatments may havebeen used in patients with a greater severity of illness. Ourexperience suggests that supportive care may be the only optionavailable. Controlled clinical studies are needed to assessthe role of antiviral drugs and corticosteroids in the treatmentof influenza A (H5N1) virus infections.
Rapid testing for influenza antigens in a small number of patientson admission was less sensitive than RT-PCR for the diagnosisof influenza A (H5N1). Our experience in this small number ofcases suggests that the low sensitivity of the rapid diagnostictests for influenza may limit their usefulness for the reliabledetection of influenza A (H5N1) in humans, especially if patientspresent relatively late in the course of illness and if otherstrains of influenza A are circulating simultaneously. The H5bprimer pair yielded positive RT-PCR results in all six patientstested in this small series, as compared with positive resultsin four of six with the use of the H5-1 and H5-2 primers onthe same samples. The N1 primers used resulted in nonspecificRT-PCR products and required modification to yield specificresults. Further evaluation of the two H5 primer systems isbeing undertaken. The sensitivity of the RT-PCR methods, whichwere designed for the identification of influenza A (H5N1) virusfrom culture, is unknown, and we urgently need new, properlyevaluated, sensitive diagnostic tests.
The clinical findings (fever, cough, diarrhea, shortness ofbreath, rapid respiratory rate, lymphopenia, and abnormalitieson chest radiography) and a history of close contact with poultrymay be more helpful in identifying patients with influenza A(H5N1) infection than the results on rapid diagnostic testsfor influenza. We do not know whether the clinical syndromedescribed on the basis of these 10 patients is representativeof the true clinical spectrum of the disease, since each ofthese patients was admitted to a referral hospital. The extentof mildly symptomatic disease in the community remains unknown.Increasing the availability of serologic tests, molecular diagnosticprocedures, and viral culture throughout Asia would help considerably.
As documented in Hong Kong in 1997 and 2003, and now in Vietnamand Thailand, the avian influenza A (H5N1) virus clearly hasthe ability to jump between species and cause devastating illnessin humans. Widespread efforts to control the poultry outbreakand increased surveillance among poultry and humans should thereforebe our highest priority. It is reassuring that to date therehas been no evidence of efficient human-to-human transmissionof influenza A (H5N1) virus in either the 1997 or the 2004 outbreak.However, the continued circulation of virulent avian influenzaA (H5N1) virus increases the possibility of the reassortmentof this virus with other circulating human influenza A virusesand increases the threat of a global influenza pandemic.
Supported by the Ministry of Health of Vietnam, the World HealthOrganization, and the Wellcome Trust. Dr. Farrar is a WellcomeTrust Senior Research Fellow.
We are indebted to the Ministry of Health of Vietnam; to thedirectors of the Hospital for Tropical Diseases, Ho Chi MinhCity; the National Pediatric Hospital, Hanoi; the PediatricHospital Number Two, Ho Chi Minh City; the National Instituteof Hygiene and Epidemiology, Hanoi; and the Pasteur Institute,Ho Chi Minh City; to Dr. Nguyen The Dung, director of the HealthService of Ho Chi Minh City, for his important contributionto this work; to Dr. Guy Thwaites and Dr. Bridget Wills forreporting the chest radiography results; to Dr. Cameron Simmonsand Ms. Bich Cau for the CD4:CD8 ratios; to Dr. Phuong Tuanfor advice on statistical analysis; and to Dr. Masaki Imai andDr. Takehiko Saito for providing the H5b primer set.
* Members of the World Health Organization International AvianInfluenza Investigative Team are listed in the Appendix.
Source Information
From the Hospital for Tropical Diseases (T.T.H., N.T.D., P.P.M., N.V.C., D.B.K., N.T. Truong) and the Oxford University Clinical Research Unit at the Hospital for Tropical Diseases (C.D., T.T.T., M.J., C.S., J.F.); Pediatric Hospital Number Two (V.C.D.); Health Service of Ho Chi Minh City (L.T.G.); the Pasteur Institute (N.T.K.T., L.H.S., L.V.T.); and the Preventive Medicine Center (N.D.T., L.H.N.) all in Ho Chi Minh City, Vietnam; the National Pediatric Hospital (N.T.L., L.T.S., P.T.S., N.T. Thi, L.P.P., C.V.T.); and the National Institute of Hygiene and Epidemiology (H.T.L., L.T.Q.M.) both in Hanoi, Vietnam; the Government Virus Unit, Department of Health, Hong Kong, China (P.C., W.L.); and the Vietnam Office, World Health Organization, Hanoi, Vietnam (P.H.). This article was published at www.nejm.org on February 25, 2004.
Address reprint requests to Dr. Farrar at the Hospital for Tropical Diseases, 190 Ben Ham Tu, Quan 5, Ho Chi Minh City, Vietnam, or at jeremyjf{at}hcm.vnn.vn.
Yuen KY, Chan PK, Peiris M, et al. Clinical features and rapid viral diagnosis of human disease associated with avian influenza A H5N1 virus. Lancet 1998;351:467-471. [CrossRef][Web of Science][Medline]
Chan PK. Outbreak of avian influenza A (H5N1) virus infection in Hong Kong in 1997. Clin Infect Dis 2002;34:Suppl 2:S58-S64.
van Kolfschooten F. Dutch veterinarian becomes first victim of avian influenza. Lancet 2003;361:1444-1444. [Web of Science][Medline]
Fouchier RA, Schneeberger PM, Rozendaal FW, et al. Avian influenza A virus (H7N7) associated with human conjunctivitis and a fatal case of acute respiratory distress syndrome. Proc Natl Acad Sci U S A 2004;101:1356-1361. [Free Full Text]
Wright KE, Wilson GA, Novosad D, Dimock C, Tan D, Weber JM. Typing and subtyping of influenza viruses in clinical samples by PCR. J Clin Microbiol 1995;33:1180-1184. [Abstract]
Mounts AW, Kwong H, Izurieta HS, et al. Case-control study of risk factors for avian influenza A (H5N1) disease, Hong Kong, 1997. J Infect Dis 1999;180:505-508. [CrossRef][Web of Science][Medline]
Bridges CB, Lim W, Hu-Primmer J, et al. Risk of influenza A (H5N1) infection among poultry workers, Hong Kong, 1997-1998. J Infect Dis 2002;185:1005-1010. [CrossRef][Web of Science][Medline]
Katz JM, Lim W, Bridges CB, et al. Antibody response in individuals infected with avian influenza A (H5N1) viruses and detection of anti-H5 antibody among household and social contacts. J Infect Dis 1999;180:1763-1770. [CrossRef][Web of Science][Medline]
Appendix
The members of the World Health Organization International AvianInfluenza Investigative Team are as follows: N. Bhat (Centersfor Disease Control and Prevention), P. Brudon (World HealthOrganization), P. Calain (World Health Organization), A. Curns(Centers for Disease Control and Prevention), R. Doran (WorldHealth Organization), K. Fukuda (Centers for Disease Controland Prevention), T. Grein (World Health Organization), P. Horby(World Health Organization), S. Itamura (National Instituteof Infectious Diseases, Tokyo, Japan), N. Miranda (World HealthOrganization), T. Uyeki (Centers for Disease Control and Prevention).
Handel, A., Longini, I. M. Jr, Antia, R.
(2010). Towards a quantitative understanding of the within-host dynamics of influenza A infections. J R Soc Interface
7: 35-47
[Abstract][Full Text]
Kumar, A., Zarychanski, R., Pinto, R., Cook, D. J., Marshall, J., Lacroix, J., Stelfox, T., Bagshaw, S., Choong, K., Lamontagne, F., Turgeon, A. F., Lapinsky, S., Ahern, S. P., Smith, O., Siddiqui, F., Jouvet, P., Khwaja, K., McIntyre, L., Menon, K., Hutchison, J., Hornstein, D., Joffe, A., Lauzier, F., Singh, J., Karachi, T., Wiebe, K., Olafson, K., Ramsey, C., Sharma, S., Dodek, P., Meade, M., Hall, R., Fowler, R. A., for the Canadian Critical Care Trials Group H1N1 C,
(2009). Critically Ill Patients With 2009 Influenza A(H1N1) Infection in Canada. JAMA
302: 1872-1879
[Abstract][Full Text]
Schmolke, M., Viemann, D., Roth, J., Ludwig, S.
(2009). Essential Impact of NF-{kappa}B Signaling on the H5N1 Influenza A Virus-Induced Transcriptome. J. Immunol.
183: 5180-5189
[Abstract][Full Text]
Marshall, H., Ryan, P., Roberton, D., Street, J., Watson, M.
(2009). Pandemic Influenza and Community Preparedness. AJPH
99: S365-S371
[Abstract][Full Text]
Hui, D. S., Chow, B. K., Ng, S. S., Chu, L. C. Y., Hall, S. D., Gin, T., Sung, J. J. Y., Chan, M. T. V.
(2009). Exhaled Air Dispersion Distances During Noninvasive Ventilation via Different Respironics Face Masks. Chest
136: 998-1005
[Abstract][Full Text]
Suzuki, K., Okada, H., Itoh, T., Tada, T., Mase, M., Nakamura, K., Kubo, M., Tsukamoto, K.
(2009). Association of Increased Pathogenicity of Asian H5N1 Highly Pathogenic Avian Influenza Viruses in Chickens with Highly Efficient Viral Replication Accompanied by Early Destruction of Innate Immune Responses. J. Virol.
83: 7475-7486
[Abstract][Full Text]
Kim, P., Sorcar, P., Um, S., Chung, H., Lee, Y. S.
(2009). Effects of episodic variations in web-based avian influenza education: influence of fear and humor on perception, comprehension, retention and behavior. Health Educ Res
24: 369-380
[Abstract][Full Text]
Szretter, K. J., Gangappa, S., Belser, J. A., Zeng, H., Chen, H., Matsuoka, Y., Sambhara, S., Swayne, D. E., Tumpey, T. M., Katz, J. M.
(2009). Early Control of H5N1 Influenza Virus Replication by the Type I Interferon Response in Mice. J. Virol.
83: 5825-5834
[Abstract][Full Text]
Xu, T., Qiao, J., Zhao, L., He, G., Li, K., Wang, J., Tian, Y., Wang, H.
(2009). Effect of dexamethasone on acute respiratory distress syndrome induced by the H5N1 virus in mice. Eur Respir J
33: 852-860
[Abstract][Full Text]
Gray, G. C., Kayali, G.
(2009). Facing pandemic influenza threats: The importance of including poultry and swine workers in preparedness plans. Poult. Sci.
88: 880-884
[Abstract][Full Text]
Wang, J., Oberley-Deegan, R., Wang, S., Nikrad, M., Funk, C. J., Hartshorn, K. L., Mason, R. J.
(2009). Differentiated Human Alveolar Type II Cells Secrete Antiviral IL-29 (IFN-{lambda}1) in Response to Influenza A Infection. J. Immunol.
182: 1296-1304
[Abstract][Full Text]
Maxmen, A.
(2009). Jeremy Farrar: When disaster strikes. JEM
206: 4-5
[Full Text]
Herold, S., Steinmueller, M., von Wulffen, W., Cakarova, L., Pinto, R., Pleschka, S., Mack, M., Kuziel, W. A., Corazza, N., Brunner, T., Seeger, W., Lohmeyer, J.
(2008). Lung epithelial apoptosis in influenza virus pneumonia: the role of macrophage-expressed TNF-related apoptosis-inducing ligand. JEM
205: 3065-3077
[Abstract][Full Text]
Droebner, K., Reiling, S. J., Planz, O.
(2008). Role of Hypercytokinemia in NF-{kappa}B p50-Deficient Mice after H5N1 Influenza A Virus Infection. J. Virol.
82: 11461-11466
[Abstract][Full Text]
Kim, J.-K., Seiler, P., Forrest, H. L., Khalenkov, A. M., Franks, J., Kumar, M., Karesh, W. B., Gilbert, M., Sodnomdarjaa, R., Douangngeun, B., Govorkova, E. A., Webster, R. G.
(2008). Pathogenicity and Vaccine Efficacy of Different Clades of Asian H5N1 Avian Influenza A Viruses in Domestic Ducks. J. Virol.
82: 11374-11382
[Abstract][Full Text]
Singh, A., Sterk, P. J.
(2008). Noninvasive ventilation and the potential risk of transmission of infection. Eur Respir J
32: 816-816
[Full Text]
Kongchanagul, A., Suptawiwat, O., Kanrai, P., Uiprasertkul, M., Puthavathana, P., Auewarakul, P.
(2008). Positive selection at the receptor-binding site of haemagglutinin H5 in viral sequences derived from human tissues. J. Gen. Virol.
89: 1805-1810
[Abstract][Full Text]
Rayner, C. R., Chanu, P., Gieschke, R., Boak, L. M., Jonsson, E. N.
(2008). Population Pharmacokinetics of Oseltamivir When Coadministered With Probenecid. J Clin Pharmacol
48: 935-947
[Abstract][Full Text]
LeBouder, F., Morello, E., Rimmelzwaan, G. F., Bosse, F., Pechoux, C., Delmas, B., Riteau, B.
(2008). Annexin II Incorporated into Influenza Virus Particles Supports Virus Replication by Converting Plasminogen into Plasmin. J. Virol.
82: 6820-6828
[Abstract][Full Text]
Sandrock, C., Stollenwerk, N.
(2008). Acute Febrile Respiratory Illness in the ICU: Reducing Disease Transmission. Chest
133: 1221-1231
[Abstract][Full Text]
Korteweg, C., Gu, J.
(2008). Pathology, Molecular Biology, and Pathogenesis of Avian Influenza A (H5N1) Infection in Humans. Am. J. Pathol.
172: 1155-1170
[Abstract][Full Text]
Nicoll, A
(2008). Children, avian influenza H5N1 and preparing for the next pandemic. Arch. Dis. Child.
93: 433-438
[Abstract][Full Text]
Song, M.-S., Oh, T.-K., Moon, H. J., Yoo, D.-W., Lee, E. H., Lee, J.-S., Kim, C.-J., Yoo, G.-J., Kim, H., Choi, Y.-K.
(2008). Ecology of H3 avian influenza viruses in Korea and assessment of their pathogenic potentials. J. Gen. Virol.
89: 949-957
[Abstract][Full Text]
Puro, V. MD, Fusco, F. M. MD, Pittalis, S. MD, Lanini, S. MD, Ippolito, G. MD
(2008). Noninvasive positive-pressure ventilation. CMAJ
178: 597-598
[Full Text]
Zeng, H., Goldsmith, C., Thawatsupha, P., Chittaganpitch, M., Waicharoen, S., Zaki, S., Tumpey, T. M., Katz, J. M.
(2007). Highly Pathogenic Avian Influenza H5N1 Viruses Elicit an Attenuated Type I Interferon Response in Polarized Human Bronchial Epithelial Cells. J. Virol.
81: 12439-12449
[Abstract][Full Text]
Saijo, M., Georges-Courbot, M.-C., Marianneau, P., Romanowski, V., Fukushi, S., Mizutani, T., Georges, A.-J., Kurata, T., Kurane, I., Morikawa, S.
(2007). Development of Recombinant Nucleoprotein-Based Diagnostic Systems for Lassa Fever. CVI
14: 1182-1189
[Abstract][Full Text]
Twu, K. Y., Kuo, R.-L., Marklund, J., Krug, R. M.
(2007). The H5N1 Influenza Virus NS Genes Selected after 1998 Enhance Virus Replication in Mammalian Cells. J. Virol.
81: 8112-8121
[Abstract][Full Text]
Salomon, R., Hoffmann, E., Webster, R. G.
(2007). Inhibition of the cytokine response does not protect against lethal H5N1 influenza infection. Proc. Natl. Acad. Sci. USA
104: 12479-12481
[Abstract][Full Text]
Carter, M. J.
(2007). A rationale for using steroids in the treatment of severe cases of H5N1 avian influenza. J Med Microbiol
56: 875-883
[Abstract][Full Text]
Ellis, J. S., Smith, J. W., Braham, S., Lock, M., Barlow, K., Zambon, M. C.
(2007). Design and Validation of an H5 TaqMan Real-Time One-Step Reverse Transcription-PCR and Confirmatory Assays for Diagnosis and Verification of Influenza A Virus H5 Infections in Humans. J. Clin. Microbiol.
45: 1535-1543
[Abstract][Full Text]
Chen, W., He, B., Li, C., Zhang, X., Wu, W., Yin, X., Fan, B., Fan, X., Wang, J.
(2007). Real-time RT-PCR for H5N1 avian influenza A virus detection. J Med Microbiol
56: 603-607
[Abstract][Full Text]
Peiris, J. S. M., de Jong, M. D., Guan, Y.
(2007). Avian Influenza Virus (H5N1): a Threat to Human Health. Clin. Microbiol. Rev.
20: 243-267
[Abstract][Full Text]
MATEO, R. I., XIAO, S.-Y., LEI, H., DA ROSA, A. P. A. T., TESH, R. B.
(2007). DHORI VIRUS (ORTHOMYXOVIRIDAE: THOGOTOVIRUS) INFECTION IN MICE: A MODEL OF THE PATHOGENESIS OF SEVERE ORTHOMYXOVIRUS INFECTION. Am J Trop Med Hyg
76: 785-790
[Abstract][Full Text]
Govorkova, E. A., Ilyushina, N. A., Boltz, D. A., Douglas, A., Yilmaz, N., Webster, R. G.
(2007). Efficacy of Oseltamivir Therapy in Ferrets Inoculated with Different Clades of H5N1 Influenza Virus. Antimicrob. Agents Chemother.
51: 1414-1424
[Abstract][Full Text]
Cooper, L. T. Jr, Mensah, G. A., Baddour, L. M., Dunbar, S. B., Kaplan, E. L., Wilson, W. R., Shah, P. K.
(2007). Task Force III: Prevention and Control of Cardiovascular Complications of Emerging Infectious Diseases and Potential Biological Terrorism Agents and Diseases. J Am Coll Cardiol
49: 1398-1406
[Full Text]
Szretter, K. J., Gangappa, S., Lu, X., Smith, C., Shieh, W.-J., Zaki, S. R., Sambhara, S., Tumpey, T. M., Katz, J. M.
(2007). Role of Host Cytokine Responses in the Pathogenesis of Avian H5N1 Influenza Viruses in Mice. J. Virol.
81: 2736-2744
[Abstract][Full Text]
Thomas, J. K., Noppenberger, J.
(2007). Avian influenza: A review. Am J Health Syst Pharm
64: 149-165
[Abstract][Full Text]
Lim, W S
(2007). Pandemic flu: clinical management of patients with an influenza-like illness during an influenza pandemic. Thorax
62: 1-46
[Full Text]
Oner, A. F., Bay, A., Arslan, S., Akdeniz, H., Sahin, H. A., Cesur, Y., Epcacan, S., Yilmaz, N., Deger, I., Kizilyildiz, B., Karsen, H., Ceyhan, M.
(2006). Avian Influenza A (H5N1) Infection in Eastern Turkey in 2006.. NEJM
355: 2179-2185
[Abstract][Full Text]
Kandun, I. N., Wibisono, H., Sedyaningsih, E. R., Yusharmen, , Hadisoedarsuno, W., Purba, W., Santoso, H., Septiawati, C., Tresnaningsih, E., Heriyanto, B., Yuwono, D., Harun, S., Soeroso, S., Giriputra, S., Blair, P. J., Jeremijenko, A., Kosasih, H., Putnam, S. D., Samaan, G., Silitonga, M., Chan, K.H., Poon, L. L.M., Lim, W., Klimov, A., Lindstrom, S., Guan, Y., Donis, R., Katz, J., Cox, N., Peiris, M., Uyeki, T. M.
(2006). Three Indonesian Clusters of H5N1 Virus Infection in 2005.. NEJM
355: 2186-2194
[Abstract][Full Text]
Majury, A., Ash, J., Toye, B., Evans, G., Mazzulli, T., Winter, A.-L., Gamble, G.
(2006). Laboratory diagnosis of human infection with avian influenza.. CMAJ
175: 1371-1371
[Full Text]
Democratis, J., Pareek, M., Stephenson, I.
(2006). Use of neuraminidase inhibitors to combat pandemic influenza. J Antimicrob Chemother
58: 911-915
[Abstract][Full Text]
Xu, T., Qiao, J., Zhao, L., Wang, G., He, G., Li, K., Tian, Y., Gao, M., Wang, J., Wang, H., Dong, C.
(2006). Acute Respiratory Distress Syndrome Induced by Avian Influenza A (H5N1) Virus in Mice. Am. J. Respir. Crit. Care Med.
174: 1011-1017
[Abstract][Full Text]
Luke, T. C., Kilbane, E. M., Jackson, J. L., Hoffman, S. L.
(2006). Meta-Analysis: Convalescent Blood Products for Spanish Influenza Pneumonia: A Future H5N1 Treatment?. ANN INTERN MED
145: 599-609
[Abstract][Full Text]
Gillim-Ross, L., Subbarao, K.
(2006). Emerging Respiratory Viruses: Challenges and Vaccine Strategies. Clin. Microbiol. Rev.
19: 614-636
[Abstract][Full Text]
Allen, P. J.
(2006). The world awaits the next pandemic: will it be H5N1, the 'bird flu'?. J Child Health Care
10: 178-187
Hui, D. S., Hall, S. D., Chan, M. T.V., Chow, B. K., Tsou, J. Y., Joynt, G. M., Sullivan, C. E., Sung, J. J.Y.
(2006). Noninvasive positive-pressure ventilation: an experimental model to assess air and particle dispersion.. Chest
130: 730-740
[Abstract][Full Text]
Hui, D. S., Ip, M., Tang, J. W., Wong, A. L.N., Chan, M. T.V., Hall, S. D., Chan, P. K.S., Sung, J. J.Y.
(2006). Airflows around oxygen masks: a potential source of infection?. Chest
130: 822-826
[Abstract][Full Text]
Thompson, C. I., Barclay, W. S., Zambon, M. C., Pickles, R. J.
(2006). Infection of human airway epithelium by human and avian strains of influenza a virus.. J. Virol.
80: 8060-8068
[Abstract][Full Text]
Bartlett, J. G.
(2006). Planning for Avian Influenza. ANN INTERN MED
145: 141-144
[Abstract][Full Text]
Monto, A. S., McKimm-Breschkin, J. L., Macken, C., Hampson, A. W., Hay, A., Klimov, A., Tashiro, M., Webster, R. G., Aymard, M., Hayden, F. G., Zambon, M.
(2006). Detection of Influenza Viruses Resistant to Neuraminidase Inhibitors in Global Surveillance during the First 3 Years of Their Use.. Antimicrob. Agents Chemother.
50: 2395-2402
[Abstract][Full Text]
Hsieh, S.-M., Chang, S.-C.
(2006). Cutting Edge: Insufficient Perforin Expression in CD8+ T Cells in Response to Hemagglutinin from Avian Influenza (H5N1) Virus.. J. Immunol.
176: 4530-4533
[Abstract][Full Text]
Fedorko, D. P., Nelson, N. A., McAuliffe, J. M., Subbarao, K.
(2006). Performance of Rapid Tests for Detection of Avian Influenza A Virus Types H5N1 and H9N2. J. Clin. Microbiol.
44: 1596-1597
[Full Text]
Treanor, J. J., Campbell, J. D., Zangwill, K. M., Rowe, T., Wolff, M.
(2006). Safety and immunogenicity of an inactivated subvirion influenza A (H5N1) vaccine.. NEJM
354: 1343-1351
[Abstract][Full Text]
Salomon, R., Franks, J., Govorkova, E. A., Ilyushina, N. A., Yen, H.-L., Hulse-Post, D. J., Humberd, J., Trichet, M., Rehg, J. E., Webby, R. J., Webster, R. G., Hoffmann, E.
(2006). The polymerase complex genes contribute to the high virulence of the human H5N1 influenza virus isolate A/Vietnam/1203/04. JEM
203: 689-697
[Abstract][Full Text]
Thorson, A., Petzold, M., Chuc, N. T. K., Ekdahl, K.
(2006). Is Exposure to Sick or Dead Poultry Associated With Flulike Illness?: A Population-Based Study From a Rural Area in Vietnam With Outbreaks of Highly Pathogenic Avian Influenza. Arch Intern Med
166: 119-123
[Abstract][Full Text]
Bartlett, J. G.
(2006). Update in Infectious Diseases. ANN INTERN MED
144: 49-56
[Full Text]
Wong, S. S. Y., Yuen, K.-y.
(2006). Avian Influenza Virus Infections in Humans. Chest
129: 156-168
[Abstract][Full Text]
Rimmelzwaan, G. F., van Riel, D., Baars, M., Bestebroer, T. M., van Amerongen, G., Fouchier, R. A.M., Osterhaus, A. D.M.E., Kuiken, T.
(2006). Influenza A Virus (H5N1) Infection in Cats Causes Systemic Disease with Potential Novel Routes of Virus Spread within and between Hosts. Am. J. Pathol.
168: 176-183
[Abstract][Full Text]
de Jong, M. D., Thanh, T. T., Khanh, T. H., Hien, V. M., Smith, G. J.D., Chau, N. V., Cam, B. V., Qui, P. T., Ha, D. Q., Guan, Y., Peiris, J.S. M., Hien, T. T., Farrar, J.
(2005). Oseltamivir Resistance during Treatment of Influenza A (H5N1) Infection. NEJM
353: 2667-2672
[Abstract][Full Text]
Kou, Z., Lei, F. M., Yu, J., Fan, Z. J., Yin, Z. H., Jia, C. X., Xiong, K. J., Sun, Y. H., Zhang, X. W., Wu, X. M., Gao, X. B., Li, T. X.
(2005). New Genotype of Avian Influenza H5N1 Viruses Isolated from Tree Sparrows in China. J. Virol.
79: 15460-15466
[Abstract][Full Text]
Beigel, J. H.
(2005). Avian influenza A (H5N1) infection in humans.. NEJM
353: 1374-1385
[Full Text]
Maines, T. R., Lu, X. H., Erb, S. M., Edwards, L., Guarner, J., Greer, P. W., Nguyen, D. C., Szretter, K. J., Chen, L.-M., Thawatsupha, P., Chittaganpitch, M., Waicharoen, S., Nguyen, D. T., Nguyen, T., Nguyen, H. H. T., Kim, J.-H., Hoang, L. T., Kang, C., Phuong, L. S., Lim, W., Zaki, S., Donis, R. O., Cox, N. J., Katz, J. M., Tumpey, T. M.
(2005). Avian Influenza (H5N1) Viruses Isolated from Humans in Asia in 2004 Exhibit Increased Virulence in Mammals. J. Virol.
79: 11788-11800
[Abstract][Full Text]
Li, Z., Chen, H., Jiao, P., Deng, G., Tian, G., Li, Y., Hoffmann, E., Webster, R. G., Matsuoka, Y., Yu, K.
(2005). Molecular Basis of Replication of Duck H5N1 Influenza Viruses in a Mammalian Mouse Model. J. Virol.
79: 12058-12064
[Abstract][Full Text]
Sturm-Ramirez, K. M., Hulse-Post, D. J., Govorkova, E. A., Humberd, J., Seiler, P., Puthavathana, P., Buranathai, C., Nguyen, T. D., Chaisingh, A., Long, H. T., Naipospos, T. S. P., Chen, H., Ellis, T. M., Guan, Y., Peiris, J. S. M., Webster, R. G.
(2005). Are Ducks Contributing to the Endemicity of Highly Pathogenic H5N1 Influenza Virus in Asia?. J. Virol.
79: 11269-11279
[Abstract][Full Text]
Lee, D. C. W., Cheung, C.-Y., Law, A. H. Y., Mok, C. K. P., Peiris, M., Lau, A. S. Y.
(2005). p38 Mitogen-Activated Protein Kinase-Dependent Hyperinduction of Tumor Necrosis Factor Alpha Expression in Response to Avian Influenza Virus H5N1. J. Virol.
79: 10147-10154
[Abstract][Full Text]
Shinya, K., Hatta, M., Yamada, S., Takada, A., Watanabe, S., Halfmann, P., Horimoto, T., Neumann, G., Kim, J. H., Lim, W., Guan, Y., Peiris, M., Kiso, M., Suzuki, T., Suzuki, Y., Kawaoka, Y.
(2005). Characterization of a Human H5N1 Influenza A Virus Isolated in 2003. J. Virol.
79: 9926-9932
[Abstract][Full Text]
Nguyen, D. C., Uyeki, T. M., Jadhao, S., Maines, T., Shaw, M., Matsuoka, Y., Smith, C., Rowe, T., Lu, X., Hall, H., Xu, X., Balish, A., Klimov, A., Tumpey, T. M., Swayne, D. E., Huynh, L. P. T., Nghiem, H. K., Nguyen, H. H. T., Hoang, L. T., Cox, N. J., Katz, J. M.
(2005). Isolation and Characterization of Avian Influenza Viruses, Including Highly Pathogenic H5N1, from Poultry in Live Bird Markets in Hanoi, Vietnam, in 2001. J. Virol.
79: 4201-4212
[Abstract][Full Text]
Matsuda, K., Shibata, T., Sakoda, Y., Kida, H., Kimura, T., Ochiai, K., Umemura, T.
(2005). In vitro demonstration of neural transmission of avian influenza A virus. J. Gen. Virol.
86: 1131-1139
[Abstract][Full Text]
de Jong, M. D., Cam, B. V., Qui, P. T., Hien, V. M., Thanh, T. T., Hue, N. B., Beld, M., Phuong, L. T., Khanh, T. H., Chau, N. V. V., Hien, T. T., Ha, D. Q., Farrar, J.
(2005). Fatal Avian Influenza A (H5N1) in a Child Presenting with Diarrhea Followed by Coma. NEJM
352: 686-691
[Abstract][Full Text]
Govorkova, E. A., Rehg, J. E., Krauss, S., Yen, H.-L., Guan, Y., Peiris, M., Nguyen, T. D., Hanh, T. H., Puthavathana, P., Long, H. T., Buranathai, C., Lim, W., Webster, R. G., Hoffmann, E.
(2005). Lethality to Ferrets of H5N1 Influenza Viruses Isolated from Humans and Poultry in 2004. J. Virol.
79: 2191-2198
[Abstract][Full Text]
Puthavathana, P., Auewarakul, P., Charoenying, P. C., Sangsiriwut, K., Pooruk, P., Boonnak, K., Khanyok, R., Thawachsupa, P., Kijphati, R., Sawanpanyalert, P.
(2005). Molecular characterization of the complete genome of human influenza H5N1 virus isolates from Thailand. J. Gen. Virol.
86: 423-433
[Abstract][Full Text]
Ungchusak, K., Auewarakul, P., Dowell, S. F., Kitphati, R., Auwanit, W., Puthavathana, P., Uiprasertkul, M., Boonnak, K., Pittayawonganon, C., Cox, N. J., Zaki, S. R., Thawatsupha, P., Chittaganpitch, M., Khontong, R., Simmerman, J. M., Chunsutthiwat, S.
(2005). Probable Person-to-Person Transmission of Avian Influenza A (H5N1). NEJM
352: 333-340
[Abstract][Full Text]
Poon, L. L. M., Leung, C. S. W., Chan, K. H., Lee, J. H. C., Yuen, K. Y., Guan, Y., Peiris, J. S. M.
(2005). Detection of Human Influenza A Viruses by Loop-Mediated Isothermal Amplification. J. Clin. Microbiol.
43: 427-430
[Abstract][Full Text]
Hien, T. T., de Jong, M., Farrar, J.
(2004). Avian Influenza -- A Challenge to Global Health Care Structures. NEJM
351: 2363-2365
[Full Text]
Maki, D. G.
(2004). SARS Revisited: The Challenge of Controlling Emerging Infectious Diseases at the Local, Regional, Federal, and Global Levels. Mayo Clin Proc.
79: 1359-1366
(2004). Update: Influenza Activity--United States and Worldwide, 2003-04 Season, and Composition of the 2004-05 Influenza Vaccine. JAMA
292: 1420-1423
[Full Text]
Trampuz, A., Prabhu, R. M., Smith, T. F., Baddour, L. M.
(2004). Avian Influenza: A New Pandemic Threat?. Mayo Clin Proc.
79: 523-530
[Abstract]