Activating Mutations in the Gene Encoding the ATP-Sensitive Potassium-Channel Subunit Kir6.2 and Permanent Neonatal Diabetes
Anna L. Gloyn, D.Phil., Ewan R. Pearson, M.R.C.P., Jennifer F. Antcliff, B.Sc., Peter Proks, D.Phil., G. Jan Bruining, M.D., Annabelle S. Slingerland, M.D., Neville Howard, M.D., F.R.A.C.P., Shubha Srinivasan, M.B., B.S., M.R.C.P., José M.C.L. Silva, M.D., Janne Molnes, M.Sc., Emma L. Edghill, M.Sc., Timothy M. Frayling, Ph.D., I. Karen Temple, F.R.C.P., Deborah Mackay, Ph.D., Julian P.H. Shield, M.D., F.R.C.P.C.H., Zdenek Sumnik, M.D., Adrian van Rhijn, M.D., Jerry K.H. Wales, D.M., F.R.C.P.C.H., Penelope Clark, Ph.D., F.R.C.Path., Shaun Gorman, M.R.C.P., Javier Aisenberg, M.D., Sian Ellard, Ph.D., M.R.C.Path., Pål R. Njølstad, M.D., Ph.D., Frances M. Ashcroft, Ph.D., and Andrew T. Hattersley, D.M., F.R.C.P.
Background Patients with permanent neonatal diabetes usuallypresent within the first three months of life and require insulintreatment. In most, the cause is unknown. Because ATP-sensitivepotassium (KATP) channels mediate glucose-stimulated insulinsecretion from the pancreatic beta cells, we hypothesized thatactivating mutations in the gene encoding the Kir6.2 subunitof this channel (KCNJ11) cause neonatal diabetes.
Methods We sequenced the KCNJ11 gene in 29 patients with permanentneonatal diabetes. The insulin secretory response to intravenousglucagon, glucose, and the sulfonylurea tolbutamide was assessedin patients who had mutations in the gene.
Results Six novel, heterozygous missense mutations were identifiedin 10 of the 29 patients. In two patients the diabetes was familial,and in eight it arose from a spontaneous mutation. Their neonataldiabetes was characterized by ketoacidosis or marked hyperglycemiaand was treated with insulin. Patients did not secrete insulinin response to glucose or glucagon but did secrete insulin inresponse to tolbutamide. Four of the patients also had severedevelopmental delay and muscle weakness; three of them alsohad epilepsy and mild dysmorphic features. When the most commonmutation in Kir6.2 was coexpressed with sulfonylurea receptor1 in Xenopus laevis oocytes, the ability of ATP to block mutantKATP channels was greatly reduced.
Conclusions Heterozygous activating mutations in the gene encodingKir6.2 cause permanent neonatal diabetes and may also be associatedwith developmental delay, muscle weakness, and epilepsy. Identificationof the genetic cause of permanent neonatal diabetes may facilitatethe treatment of this disease with sulfonylureas.
Neonatal diabetes may be defined as insulin-requiring hyperglycemiathat is diagnosed within the first three months of life. Itmay be either transient, resolving within a median of threemonths, or permanent, in which case insulin treatment is requiredfor life.1 Substantial progress has been made in our understandingof transient neonatal diabetes, with the majority of cases beingattributable to an abnormality in an imprinted region of chromosome6.2 In most patients, the cause of permanent neonatal diabetesis unknown; homozygous and compound heterozygous mutations inthe gene encoding glucokinase account for a minority of cases,3,4,5,6and the genes for some very rare, multisystem conditions thatinclude neonatal diabetes have been identified.7,8,9
ATP-sensitive potassium (KATP) channels play a central rolein glucose-stimulated insulin secretion from pancreatic betacells: insulin secretion is initiated by closure of the channelsand inhibited by their opening (Figure 1).10 The beta-cell KATPchannel is an octameric complex of four pore-forming, inwardlyrectifying potassium-channel subunits (Kir6.2) and four regulatorysulfonylurea-receptor subunits (SUR1).11 Both Kir6.2 and SUR1are required for correct metabolic regulation of the channel:ATP closes the channel by binding to Kir6.2, and magnesium nucleotides(Mg-ADP and Mg-ATP) stimulate channel activity by interactingwith SUR1. Sulfonylureas stimulate insulin secretion in type2 diabetes by binding to SUR1 and closing KATP channels by anATP-independent mechanism.10
Figure 1. Schematic Representation of the Pancreatic Beta Cell, Illustrating the Role of the ATP-Sensitive Potassium (KATP) Channel in Insulin Secretion.
Glucose enters the beta cell by way of the GLUT2 glucose transporter. Once inside the cell, glucose is metabolized, leading to changes in the intracellular concentration of adenine nucleotides that inhibit the KATP channel and thus cause channel closure. The KATP channel consists of four sulfonylurea-receptor (SUR1) subunits and four Kir6.2 subunits in an octomeric structure. Channel closure leads to membrane depolarization, which subsequently activates voltage-dependent calcium (Ca2+) channels, leading in turn to an increase in intracellular Ca2+, which triggers insulin exocytosis. Sulfonylureas initiate secretion by directly binding to the SUR1 subunits of KATP channels and causing channel closure. Mg-ADP denotes magnesium ADP.
We hypothesized that activating mutations in the gene encodingthe Kir6.2 subunit of the beta-cell KATP channel (KCNJ11) causemonogenic diabetes, because inactivating mutations in this genelead to uncontrolled insulin secretion and congenital hyperinsulinism.12The contrasting phenotypes of permanent neonatal diabetes andhyperinsulinism are seen with inactivating and activating mutations,respectively, of the gene encoding glucokinase.3,13,14 Strongsupport for our hypothesis comes from the observation that transgenicmice with overactive beta-cell KATP channels have profound neonataldiabetes.15 We therefore sequenced the gene encoding Kir6.2in patients who had permanent neonatal diabetes or dominantlyinherited maturity-onset diabetes of the young (MODY).
Methods
Patients
We sequenced the DNA of 29 probands with permanent neonataldiabetes, mainly from the International Society for Pediatricand Adolescent Diabetes (ISPAD) Rare Diabetes Collection. Patientswere registered in the collection or were recruited for thestudy between September 2001 and October 2003. Patients withabnormalities in chromosome 6q24, mutations in the gene encodingglucokinase, exocrine pancreatic insufficiency, and pancreaticagenesis were excluded. We also sequenced the DNA of 15 probandswith MODY from families in the United Kingdom in whom mutationsin the six known MODY-associated genes had been ruled out.16Written informed consent was obtained from all the patientsor their parents.
Mutational Analyses
The coding region and the intronexon boundaries of KCNJ11were amplified from genomic DNA by the polymerase chain reactionwith the use of previously described primers17 in addition tofragment 5R 5'CTGTGGTCCTCATCAAGCTG3', fragment 6F 5'GCTGAGGAGGACGGACGTTAC3',and fragment 6R 5'CCACATGGTCCGTGTGTACACACG3'. The products weresequenced by standard methods. Family relationships were confirmedwith the use of a panel of 10 microsatellite markers.
Clinical Studies
All patients with mutations in the gene encoding Kir6.2 underwentclinical examinations, including detailed developmental andneurologic assessments by a consultant pediatrician or physician,and their medical records were reviewed. Electrocardiogramswere examined for evidence of arrhythmias and for measurementof the QT interval. All physiological tests were performed afterthe patients had fasted overnight. A glucagon stimulation testwas performed as follows: 15 µg of glucagon per kilogramof body weight (maximal dose, 1 mg) was given intravenouslyat time 0, and blood samples for measurement of C-peptide wereobtained at 10, 5, 0, 2, 4, 6, 8, 10, 15, and20 minutes. The highest C-peptide value was then recorded. Atolbutamide-modified, frequently sampled intravenous glucose-tolerancetest was performed as previously described.18 After base-linesampling, a bolus of 0.3 g of glucose per kilogram was givenintravenously, followed by a bolus of 3 mg of tolbutamide perkilogram 20 minutes later. We calculated the peak incrementalinsulin response after the glucose bolus and after the tolbutamidebolus.
Functional Studies
Wild-type mouse Kir6.2 or Kir6.2 in which histidine replacedarginine at position 201 (R201H) was coexpressed with rat SUR1(containing exon 17) in Xenopus laevis oocytes, and KATP currentswere recorded as previously described.19,20 To simulate theeffect of heterozygosity, we injected oocytes with SUR1 anda 1:1 mixture of Kir6.2 and Kir6.2-R201H messenger RNA (mRNA).ATP concentrationresponse curves were fitted accordingto the Hill equation: I ÷ IC = 1 ÷ [1 + ([ATP]÷ IC50)h], where I is the KATP current, IC is the currentin the absence of nucleotide, [ATP] is the ATP concentration,IC50 is the ATP concentration at which inhibition is half maximal,and h is the Hill coefficient. Data are given as means ±SE.
Results
Mutational Analyses
We identified six novel, heterozygous mutations in the geneencoding Kir6.2 in 10 of the 29 probands who had permanent neonataldiabetes. The mutations were a glutamine-to-arginine substitutionat position 52 (Q52R), a valine-to-glycine substitution at position59 (V59G), a valine-to-methionine substitution at position 59(V59M), an arginine-to-histidine substitution at position 201(R201H), an arginine-to-cysteine substitution at position 201(R201C), and an isoleucine-to-leucine substitution at position296 (I296L). No mutations were found in any of the probandswho had MODY. The R201H missense mutation was identified in4 of these 10 probands, and the V59M missense mutation was detectedin 2. In all the families, neonatal diabetes was seen only inpersons who had Kir6.2 mutations, and all family members whodid not have these mutations were not diabetic (Figure 2).
Figure 2. Diabetes Status and Mutations in the Gene Encoding Kir6.2 in 10 Families.
These partial pedigrees show families with the Q52R, V59G, V59M, R201C, R201H, and I296L mutations. In all the pedigrees for which parental DNA was available, family relationships were confirmed by a panel of 10 microsatellites. In ISPAD pedigrees 19, 22, 27, 41, 43, 44, 54, and 55, spontaneous mutations explain the absence of permanent neonatal diabetes in the parents and its presence in a child. Squares represent male family members, circles female family members, and diamonds sex not defined; blue circles and squares represent persons with neonatal diabetes; a slash mark indicates deceased. The numbers inside diamonds indicate the number of unaffected siblings. A two-letter code for allele status is shown underneath each symbol: N denotes no mutation, M mutation, and NA not available for testing. P and an arrow denote the proband in each family (the first affected member recruited for this study). Amino acids are denoted by their single-letter codes.
In two families (ISPAD 19 and BR 1), neonatal diabetes had beentransmitted from an affected parent to his or her offspring.Because both maternal and paternal transmission can occur, imprintingof this locus is unlikely. In nine cases, DNA was availablefrom both unaffected parents, and paternity was established;the mutations were shown to have arisen spontaneously. Noneof the mutations were present in 100 nondiabetic subjects fromthe United Kingdom.
Figure 3 shows the location of mutated residues in Kir6.2. Allthe mutated residues are conserved among humans, rats, mice,and bullfrogs. The arginine residue at position 201 is conservedamong 10 members of the family of Kir channels, a finding thatsupports the possibility that this residue has a critical rolein channel function. In addition, we identified several previouslyrecognized polymorphisms (a glutamic acidtolysinesubstitution at position 23 [E23K], a silent alanine-to-alaninesubstitution at position 190 [A190A], a silent leucine-to-leucinesubstitution at position 267 [L267L], a leucine-to-valine substitutionat position 270 [L270V], an isoleucine-to-valine substitutionat position 337 (I337V], a silent lysine-to-lysine substitutionat position 381 [K381K], and a serine-to-cysteine substitutionat position 385 [S385C]).
Figure 3. Illustration of Two Kir6.2 Subunits, Showing the Mutations Identified in Patients with Permanent Neonatal Diabetes.
The illustration is based on the crystal structure of the potassium channel KirBac1.1.21 The alpha-helical slide helix is shown in green, the selectivity filter in orange, and the C-terminal beta sheets in blue. The residues affected by mutations in patients with neonatal diabetes (Q52, V59, R201, and I296) are shown in yellow. Amino acids are denoted by their single-letter codes. The shaded band represents the cell membrane, and the blue circles the potassium ion. The labels "External" and "Internal" refer to areas outside and inside the cell.
Clinical Characteristics
The clinical characteristics of patients with mutations areshown in Table 1. There were two subgroups of patients: thosewho had only diabetes and those who had diabetes and sharedneurologic abnormalities. Diabetes and low birth weight reflectimpaired intrauterine and postnatal insulin secretion and weresimilar in the two subgroups of patients.
Table 1. Clinical Characteristics of Patients with Mutant Kir6.2.
Diabetes
Diabetes was diagnosed at a mean age of 7 weeks (range, birthto 26 weeks). At diagnosis, all the patients had marked hyperglycemia(glucose concentration, 270 to 972 mg per deciliter [15 to 54mmol per liter]), and three had ketoacidosis. None of the patientshad elevated concentrations of autoantibodies associated withtype 1 diabetes, and the C-peptide concentration was usuallyless than 200 pmol per liter. The median dose of insulin was0.8 U per kilogram (range, 0.3 to 1.3). Only one patient (theproband's father in family BR 1) was not treated with insulin.He had received tolbutamide since childhood, and at 46 yearsof age, he had good control of the disease with this medication(fasting glucose concentration, 110 mg per deciliter [6.1 mmolper liter]; C-peptide concentration, 400 pmol per liter).
Low Birth Weight
Low birth weight was a feature of all the patients; in 7 of12 (58 percent) the birth weight was at or below the 3rd percentile.Patients who did not have neurologic symptoms (Table 1) showedmarked catch-up growth after birth, and their weights and heightswere normally distributed on follow-up after a mean of 9.3 years.
Neurologic Features
Three of the patients (the probands in families ISPAD 25, ISPAD27, and ISPAD 43) had very similar neurologic abnormalities,which suggested extrapancreatic phenotypes associated with theirKir6.2 mutation (Table 1). All three had marked developmentaldelay, muscle weakness, epilepsy, and dysmorphic features aswell as neonatal diabetes. Another patient (the proband in familyISPAD 55) had an intermediate phenotype involving severe developmentaldelay and muscle weakness in addition to neonatal diabetes,but no other neurologic features. No cause other than theirKir6.2 mutation was found for their neurologic problems. Allchildren had normal karyotypes. The other patients had normaldevelopment, indicating that not all mutations in Kir6.2 areassociated with neurologic abnormalities.
Developmental Delay
All four patients with common neurologic features had markeddevelopmental delay involving failure to achieve motor, intellectual,and social milestones appropriate for their age. The motor delaywas the most marked of these features; the oldest child wasunable to walk unaided at the age of 17 years, and all fourchildren showed motor development that was consistent with thatof children half their chronologic age or younger. There wasmuscular weakness on neurologic examination in all four cases.The creatine kinase concentration was normal in all of them.Muscle-biopsy specimens obtained from two of the patients werenormal, and electromyography performed in two confirmed thatnerve conduction was normal. In one patient action potentialsof decreased duration and amplitude suggested a myopathy.
Social and language development was also markedly delayed inthese four patients. None of them had microcephaly, and magneticresonance imaging (MRI) and computed tomographic studies showedno reduction in the size of the cortex or cerebellum. No structuralabnormalities were seen, apart from small, nonspecific, generalizedpatches throughout the white matter in one patient (the probandin family ISPAD 43) on an MRI scan obtained when she was 14years of age.
Epilepsy
Generalized seizures, either complex or myoclonic, were observedin three patients (the probands in families ISPAD 25, ISPAD27, and ISPAD 43) beginning in the first year of life. The seizuresresponded to antiepileptic medication (vigabatrin in two patientsand sodium valproate in one). The seizures preceded clinicallyrecognized episodes of hypoglycemia. All electroencephalogramsshowed generalized abnormal activity with bilateral sharp waves.One patient had marked hypsarrhythmia, which responded to vigabatrin.
Dysmorphic Features
All three patients with epilepsy had mild dysmorphic features(see Supplementary Appendix 1, available with the full textof this article at www.nejm.org). Their appearance was characterizedby a prominent metopic suture, a downturned mouth, and bilateralptosis. All three patients had limb contractures, which werediagnosed at birth in two and at four years of age in one.
Physiological Studies
Both during fasting and after glucagon stimulation, the serumC-peptide concentration was generally less than 200 pmol perliter, despite marked hyperglycemia a finding consistentwith profound beta-cell dysfunction (Table 1). Serum C-peptideexceeded the lower limit of the normal range in only three patients(two insulin-treated children and the adult whose diabetes waswell controlled with tolbutamide) (Table 1). Three patients,who had mutations affecting residue 201, had only minimal insulinsecretion in response to intravenous glucose but did secreteinsulin in response to tolbutamide (Figure 4).
Figure 4. Insulin Secretory Responses to Intravenous Glucose and to Tolbutamide.
The results are presented as the peak increase in the insulin level from base line in response to 0.3 g of intravenous glucose per kilogram and 3 mg of intravenous tolbutamide per kilogram for three members of ISPAD families 19 and 41.
Functional Analysis of the R201H Mutation
When wild-type Kir6.2 was coexpressed with SUR1 in X. laevisoocytes, KATP currents were almost undetectable because of inhibitionby high intracellular ATP concentrations, but they could beactivated by azide, which lowers cytosolic ATP concentrations(Figure 5A). In contrast, significant resting currents wererecorded from oocytes expressing Kir6.2-R201HSUR1 (P<0.01for the comparison with wild-type Kir6.2). These currents werefurther activated by azide (P<0.05 for the comparison withwild-type Kir6.2) and were blocked by tolbutamide, indicatingthat they flow through KATP channels (Figure 5B and Figure 5C).These data suggest that metabolism causes less blockade of Kir6.2-R201HSUR1channels than it does of wild-type KATP channels.
Figure 5. The Effects of Metabolic Inhibition, a Sulfonylurea, and Intracellular ATP on Currents in Wild-Type and Mutant ATP-Sensitive Potassium (KATP) Channels.
Whole-cell currents were recorded in a two-electrode voltage clamp from intact oocytes expressing Kir6.2SUR1 (Panel A) or Kir6.2-R201HSUR1 (Panel B) in response to voltage steps of ±20 mV from a holding potential of 10 mV. The external solution consisted of 90 mM potassium chloride, 1 mM magnesium chloride, 1.8 mM calcium chloride, and 5 mM HEPES (pH 7.4 with potassium hydroxide), plus 3 mM azide and 500 µM tolbutamide as indicated. Panel C shows the mean whole-cell current evoked by a voltage step from 10 to 30 mV in control solution, then after steady state was reached with 3 mM azide, then in the continued presence of azide plus 500 µM tolbutamide. Oocytes were injected with messenger RNA encoding SUR1 plus either Kir6.2 (six oocytes), Kir6.2-R201H (seven), or a 1:1 mixture of Kir6.2 and Kir6.2-R201H (seven). The T bars represent standard errors. Panel D shows the KATP current recorded in response to voltage ramps from 110 to +100 mV from an inside-out patch excised from an X. laevis oocyte coexpressing SUR1 and either wild-type or mutant Kir6.2, as indicated. The dashed line indicates the zero current level. The pipette solution consisted of 140 mM potassium chloride, 1.2 mM magnesium chloride, 2.6 mM calcium chloride, and 10 mM HEPES (pH 7.4 with potassium hydroxide). The internal solution consisted of 107 mM potassium chloride, 1 mM potassium sulfate, 1 mM calcium chloride, 10 mM EGTA (egtazic acid), 10 mM HEPES (pH 7.2 with potassium hydroxide), and 100 µM ATP, as indicated. Panel E shows the relation between the ATP concentration and the KATP current, expressed relative to the current in the absence of nucleotide, for Kir6.2SUR1 in six oocytes (open circles), Kir6.2-R201HSUR1 in six oocytes (solid circles), and a 1:1 mixture of Kir6.2-R201H and Kir6.2 coexpressed with SUR1 in six oocytes (diamonds). The lines are the best fit of the Hill equation to the mean data: for Kir6.2SUR1, the concentration at which inhibition is half maximal (IC50) is 6.6 µM, and the Hill coefficient (h) is 1.1; for Kir6.2-R201HSUR1, IC50 is 245 µM and h is 2. For the 1:1 mixture, the line is the best fit to the following equation: a(1 ÷ [1 + ([ATP] ÷ 245 µM)2]) + (1 a)(1 ÷ [1 +( [ATP] ÷ IC50)h]), where [ATP] is the ATP concentration, IC50 is 7.6 µM, h is 1.6, and a (the fraction of the homomeric R201H channels) is 0.04.
To explore the mechanisms underlying these findings, we examinedthe nucleotide sensitivity of wild-type and mutant channelsin inside-out patches (Figure 5D). Kir6.2-R201HSUR1 channelswere considerably less sensitive than wild-type channels tointracellular ATP; mutant channels were half maximally blockedat an ATP concentration of 262±33 µM, as comparedwith an ATP concentration of 7±1 µM for Kir6.2SUR1channels (P<0.001) (Figure 5E). However, mutant channelswere activated by Mg-ADP to a similar extent. The single-channelconductance and the fraction of time the channel spends in theopen state (the "open probability") were normal.
To simulate the effect of heterozygosity, we injected oocyteswith SUR1 and a 1:1 mixture of Kir6.2 and Kir6.2-R201H mRNA.The resting current of oocytes injected with the 1:1 mixturewas slightly, but not significantly, greater (0.27±0.07nA) than that of oocytes with the wild-type channel (0.13±0.05nA) (P=0.12) (Figure 5C). The KATP currents of mutant channelswere further activated by azide and blocked by tolbutamide,to an extent similar to that in the wild-type channel. The ATPsensitivity was also close to that of the wild-type channel,with an IC50 value of 7.6±0.4 µM (Figure 5E). However,the KATP currents of mutant channels were significantly largerthan those of wild-type channels at ATP concentrations of 1µM (P=0.002) and 3 µM (P=0.008), due to the differencein the Hill coefficient.
Discussion
Our findings show that heterozygous activating mutations inthe gene encoding the Kir6.2 subunit of the KATP channel cancause both familial and sporadic neonatal diabetes. This geneticsubtype may be a relatively common cause of permanent neonataldiabetes, since we found it in 34 percent of probands. Somepatients with mutations in the gene encoding Kir6.2 have markeddevelopmental delay, muscle weakness, and epilepsy, in additionto neonatal diabetes. These observations point to the criticalrole of KATP channels in pancreatic beta cells and suggest arole in human muscle and brain.
The evidence that these mutations are causal is very strong.They cosegregated with diabetes in the two families with verticaltransmission, and the nonfamilial cases of diabetes were associatedwith spontaneous mutations (since the mutation was not presentin the normoglycemic parents). Approximately 1 in 106 peopleis likely to have a spontaneous mutation in a gene of this size,so nine such mutations is highly unlikely to be a chance observation.The most common mutation (resulting in the R201H substitution)occurs within a CpG dinucleotide, a "hot spot" for mutationsin mammalian genes. This probably explains the recurrent findingof the R201H mutation in unrelated families from different countries.Since the majority of the mutations are spontaneous, a familyhistory of diabetes is frequently not present.
Diabetes was diagnosed at a mean age of seven weeks and withinthe first three months of life in 10 of the 13 patients. Althoughthree patients presented with ketoacidosis, it is likely thatat least some patients had minimal secretion of endogenous insulin,since in most patients the disease was not diagnosed immediatelyafter birth, and some had detectable C-peptide concentrations.Patients with Kir6.2 mutations may show some overlap with type1 diabetes in terms of clinical features, but none of our patientshad beta-cell autoantibodies. The extent to which mutationsin the gene encoding Kir6.2 account for antibody-negative type1 diabetes requires investigation.
The severe intrauterine growth retardation found in the patientswith Kir6.2 mutations is consistent with greatly reduced orabsent insulin secretion in utero and is also seen in patientswith glucokinase deficiency, loss of an imprinted region ofchromosome 6q24 (which results in transient neonatal diabetes),and pancreatic agenesis.2,3,7,23 Marked postnatal catch-up growthis a feature of these conditions and was also observed in thepatients with Kir6.2 mutations who did not have neurologic abnormalities.
Mutations in the gene encoding Kir6.2 probably cause decreasedsecretion of insulin from beta cells by conferring reduced sensitivityto ATP, which is predicted to result in gain of channel function.Functional analysis of the most common mutation, R201H, showedthat the homozygous mutation led to markedly reduced sensitivityto ATP. When wild-type and mutant subunits were coexpressedto simulate the heterozygous state, the ATP sensitivity of theresulting mixed population of heteromeric channels was similarto that of the wild type, except at low ATP concentrations.However, we expect that there will be a small population ofhomomeric R210H channels with lower ATP sensitivity (about 6percent of the channels if the number of mutant subunits inthe tetrameric channel is binomially distributed). Indeed, suchATP-insensitive channels were observed at the single-channellevel (data not shown). Although this current is difficult tomeasure at high ATP concentrations, it may be sufficient tokeep the beta cell hyperpolarized even in the presence of glucose,thereby reducing electrical activity and insulin release. Ourresults indicate that very small changes in the resting KATPcurrent, due to small changes in ATP sensitivity, can impairinsulin secretion sufficiently to cause diabetes in humans.This finding is consistent with some24 but not all25 in vitrostudies that suggest that a Kir6.2 polymorphism in which lysinereplaces glutamic acid at position 23 (E23K) shows small changesin ATP sensitivity.
A molecular model of the C terminal of Kir6.226 predicts thatR201 lies close to the phosphate tail of ATP and that it interactswith the alpha phosphate of ATP. The concept of a critical rolefor residue 201 in ATP binding is supported by the finding thatthe ATP sensitivity of KATP channels is reduced when the arginineat position 201 is mutated to histidine and other residues.27,28Three mutations (Q52R, V59M, and V59G) are found in the slidehelix; residue 52 lies at one end of the helix, and residue59 lies midway along its length (Figure 3). The position ofthe slide helix implies a role in the regulation of channelgating,21 but it lies distant from the predicted ATP-bindingsite. Additional work is required to elucidate the mechanismby which the mutations that lie in the slide-helix domain effectdisease.
Identification of mutations in the gene encoding the KATP-channelsubunit Kir6.2 may have important implications for the treatmentof affected patients. Our functional studies in vitro suggestthat if the KATP channel could be closed by an ATP-independentmechanism (e.g., by sulfonylureas), insulin secretion mightbe restored. Patients with mutations affecting position 201did have clear, but subnormal, insulin responses to intravenoustolbutamide. This observation suggests that the pathophysiologicalcondition in humans mirrors the findings in vitro, raising thepossibility of novel treatment strategies based on sulfonylureas(or other specific KATP-channel inhibitors) in these apparentlyinsulin-dependent patients. Of note, one patient with an R201Hmutation (the proband's father in family BR 1), who had alwaysbeen treated with tolbutamide, had C-peptide levels in the normalrange and good glycemic control. Further investigation is neededto determine whether the identification of a mutation in thegene encoding Kir6.2 will permit treatment to be given in theform of oral agents rather than subcutaneously injected insulin.
It is unlikely that the severe developmental delay, muscle weakness,and epilepsy seen in a subgroup of the patients with Kir6.2mutations result from diabetes or its treatment. Severe developmentaldelay and persistent epilepsy are rare in children with neonataldiabetes2,3,6,7; moreover, in our study, neurologic diagnosispreceded clinically recognized episodes of hypoglycemia, andthe contractures seen at birth in two of the patients suggestthat neurologic dysfunction was present in utero. Kir6.2 isthe pore-forming subunit of KATP channels in skeletal muscleand neurons throughout the brain29,30; hence, altered activityof these channels could cause developmental delay, muscle weakness,and epilepsy. Studies in animal models to assess skeletal muscleand the neurologic effects of gain-of-function mutations havenot been performed; however, loss of function of the KATP channelcan result in hypoxia-induced seizures,31 and overexpressionof SUR1 in forebrain reduces the susceptibility to seizures.32Analysis of additional patients will be necessary to determinewhether Kir6.2 mutations give rise to a discrete syndrome characterizedby developmental delay, epilepsy, and neonatal diabetes.
The position and type of the mutation may influence the phenotype.All eight patients with mutations at residue 201 had diabetesbut no neurologic abnormalities. The V59M variant is associatedboth with isolated diabetes and with marked developmental delayin addition to diabetes. This kind of genetic behavior one in which the same mutation is associated with differentphenotypes in different families has been observed withother genes, such as LMNA.33
That heterozygous mutations of Kir6.2 cause diabetes confirmsthat the KATP-channeldependent pathway is critical forinsulin secretion and that other, KATP-channelindependentpathways are unable to compensate for its loss. Mutations witha less severe functional effect or modification by the geneticbackground might lead to transient neonatal diabetes or to diabetesthat becomes manifest after the neonatal period. Indeed, weand others have shown that the common Kir6.2 polymorphism E23Kis associated with a slightly increased susceptibility to type2 diabetes.24,34,35
In conclusion, activating mutations in the gene encoding theATP-sensitive potassium-channel subunit Kir6.2 cause neonataldiabetes, and in some patients, neurologic abnormalities. Thepreliminary finding that tolbutamide partly compensates forthe effect of the most common mutation on insulin secretionoffers hope that in at least some cases the diabetes may beeffectively treated with sulfonylurea tablets.
Supported in part by funds from the Wellcome Trust and DiabetesUK (to the Institute of Biomedical and Clinical Science, PeninsulaMedical School, Exeter); by grants from the Royal Society, theWellcome Trust, and the Medical Research Council (to the Laboratoryof Physiology, Oxford University, Oxford); by a grant from theDutch Growth Foundation (to Dr. Slingerland); and by grantsfrom the University of Bergen and Haukeland University Hospital(to the Institute for Clinical Medicine and Molecular Medicine,University of Bergen, Bergen). Dr. Hattersley is a WellcomeTrust Clinical Research Leave Fellow, Dr. Pearson is a WellcomeTrust Clinical Research Fellow, and Dr. Ashcroft is the RoyalSociety GlaxoSmithKline Research Professor.
We are indebted to the International Society for Pediatric andAdolescent Diabetes, which set up the ISPAD Rare Diabetes registry;to the Child Health and Well-Being Fund, Rotterdam, the Netherlands,which funded its establishment; to Peter Turnpenny and JuliaRankin for their advice; and to the Royal Devon and Exeter NationalHealth Service Health Care Trust for their continued support.
* Dr. Pearson, Ms. Antcliff, and Dr. Proks contributed equallyto the article.
Source Information
From the Institute of Biomedical and Clinical Science, Peninsula Medical School, Exeter, United Kingdom (A.L.G., E.R.P., E.L.E., T.M.F., S.E., A.T.H.); the University Laboratory of Physiology, Oxford University, Oxford, United Kingdom (J.F.A., P.P., F.M.A.); Sophia Children's Hospital, Rotterdam, the Netherlands, (G.J.B., A.S.S.); the Institute of Endocrinology and Diabetes, Children's Hospital at Westmead, Westmead, Australia (N.H., S.S.); Piaui State University Medical School, Teresina, Piaui, Brazil (J.M.C.L.S.); the Institute for Clinical Medicine and Molecular Medicine, University of Bergen, Bergen, Norway (J.M., P.R.N.); Wessex Clinical Genetics Service and the Division of Human Genetics, Southampton University and Hospitals, National Health Service Trust, Southampton, United Kingdom (I.K.T.); Wessex Regional Genetics Laboratories, Salisbury District Hospital, Salisbury, United Kingdom (D.M.); Royal Hospital for Children, Bristol, United Kingdom (J.P.H.S.); Second Department of Pediatrics and Second Faculty of Medicine, Charles University, Prague, Czech Republic (Z.S.); Meander Medical Center, Amersfoort, the Netherlands (A.R.); Academic Unit of Child Health, Sheffield Children's Hospital, Sheffield, United Kingdom (J.K.H.W.); Regional Endocrine Laboratory, Birmingham, United Kingdom (P.C.); St. Luke's Hospital, Bradford, United Kingdom (S.G.); and the Division of Pediatric Endocrinology and Diabetes, Hackensack University Medical Center, Hackensack, N.J. (J.A.).
Address reprint requests to Dr. Hattersley at Diabetes and Vascular Medicine, Institute of Biomedical and Clinical Science, Peninsula Medical School, Barrack Rd., Exeter EX2 5AX, United Kingdom, or at a.t.hattersley{at}ex.ac.uk.
References
Shield JP. Neonatal diabetes: new insights into aetiology and implications. Horm Res 2000;53:Suppl 1:7-11. [Web of Science][Medline]
Temple IK, Gardner RJ, Mackay DJ, Barber JC, Robinson DO, Shield JP. Transient neonatal diabetes: widening the understanding of the etiopathogenesis of diabetes. Diabetes 2000;49:1359-1366. [Abstract]
Njølstad PR, Søvik O, Cuesta-Muñoz A, et al. Neonatal diabetes mellitus due to complete glucokinase deficiency. N Engl J Med 2001;344:1588-1592. [Free Full Text]
Gloyn AL, Ellard S, Shield JP, et al. Complete glucokinase deficiency is not a common cause of permanent neonatal diabetes. Diabetologia 2002;45:290-290. [CrossRef][Web of Science][Medline]
Vaxillaire M, Samson C, Cave H, Metz C, Froguel P, Polak M. Glucokinase gene mutations are not a common cause of permanent neonatal diabetes in France. Diabetologia 2002;45:454-455. [CrossRef][Web of Science][Medline]
Njølstad PR, Sagen JV, Bjorkhaug L, et al. Permanent neonatal diabetes caused by glucokinase deficiency: inborn error of glucose-insulin signaling pathway. Diabetes 2003;52:2854-2860. [Free Full Text]
Stoffers DA, Zinkin NT, Stanojevic V, Clarke WL, Habener JF. Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat Genet 1997;15:106-110. [CrossRef][Web of Science][Medline]
Delepine M, Nicolino M, Barrett T, Golamaully M, Lathrop GM, Julier C. EIF2AK3, encoding translation initiation factor 2-alpha kinase 3, is mutated in patients with Wolcott-Rallison syndrome. Nat Genet 2000;25:406-409. [CrossRef][Web of Science][Medline]
Wildin RS, Ramsdell F, Peake J, et al. X-linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy. Nat Genet 2001;27:18-20. [CrossRef][Web of Science][Medline]
Gribble FM, Reimann F. Sulphonylurea action revisited: the post-cloning era. Diabetologia 2003;46:875-891. [CrossRef][Web of Science][Medline]
Clement JP IV, Kunjilwar K, Gonzalez G, et al. Association and stoichiometry of K(ATP) channel subunits. Neuron 1997;18:827-838. [CrossRef][Web of Science][Medline]
Thomas PM, Ye Y, Lightner E. Mutation of the pancreatic islet inward rectifier, Kir6.2 also leads to familial persistent hyperinsulinemic hypoglycemia of infancy. Hum Mol Genet 1996;5:1809-1812. [Free Full Text]
Glaser B, Kesavan P, Heyman M, et al. Familial hyperinsulinism caused by an activating glucokinase mutation. N Engl J Med 1998;338:226-230. [Free Full Text]
Nichols CG, Koster JC. Diabetes and insulin secretion: whither KATP? Am J Physiol Endocrinol Metab 2002;283:E403-E412. [Free Full Text]
Koster JC, Marshall BA, Ensor N, Corbett JA, Nichols CG. Targeted overactivity of beta cell K(ATP) channels induces profound neonatal diabetes. Cell 2000;100:645-654. [CrossRef][Web of Science][Medline]
Frayling TM, Lindgren CM, Chevre JC, et al. A genome-wide scan in families with maturity-onset diabetes of the young: evidence for further genetic heterogeneity. Diabetes 2003;52:872-881. [Free Full Text]
Inoue H, Ferrer J, Warren-Perry M, et al. Sequence variants in the pancreatic islet beta-cell inwardly rectifying K+ channel Kir6.2 (Bir) gene: identification and lack of role in Caucasian patients with NIDDM. Diabetes 1997;46:502-507. [Abstract]
Pearson ER, Starkey BJ, Powell RJ, Gribble FM, Clark PM, Hattersley AT. Genetic cause of hyperglycaemia determines response to treatment in diabetes. Lancet 2003;362:1275-1281. [CrossRef][Web of Science][Medline]
Gribble FM, Ashfield R, Ämmälä C, Ashcroft FM. Properties of cloned ATP-sensitive K+ currents expressed in Xenopus oocytes. J Physiol 1997;498:87-98. [Free Full Text]
Trapp S, Proks P, Tucker SJ, Ashcroft FM. Molecular analysis of ATP-sensitive K channel gating and implications for channel inhibition by ATP. J Gen Physiol 1998;112:333-349. [Free Full Text]
Kuo A, Gulbis JM, Antcliff JF, et al. Crystal structure of the potassium channel KirBac1.1 in the closed state. Science 2003;300:1922-1926. [Free Full Text]
Freeman JV, Cole TJ, Chinn S, Jones PR, White EM, Preece MA. Cross sectional stature and weight reference curves for the UK, 1990. Arch Dis Child 1995;73:17-24. [Free Full Text]
Hattersley AT, Beards F, Ballantyne E, Appleton M, Harvey R, Ellard S. Mutations in the glucokinase gene of the fetus result in reduced birth weight. Nat Genet 1998;19:268-270. [CrossRef][Web of Science][Medline]
Schwanstecher C, Meyer U, Schwanstecher M. K(IR)6.2 polymorphism predisposes to type 2 diabetes by inducing overactivity of pancreatic beta-cell ATP-sensitive K(+) channels. Diabetes 2002;51:875-879. [Free Full Text]
Riedel MJ, Boora P, Steckley D, de Vries G, Light PE. Kir6.2 polymorphisms sensitize beta-cell ATP-sensitive potassium channels to activation by acyl CoAs: a possible cellular mechanism for increased susceptibility to type 2 diabetes? Diabetes 2003;52:2630-2635. [Free Full Text]
Trapp S, Haider S, Jones P, Sansom MS, Ashcroft FM. Identification of residues contributing to the ATP binding site of Kir6.2. EMBO J 2003;22:2903-2912. [CrossRef][Web of Science][Medline]
Ribalet B, John SA, Weiss JN. Molecular basis for Kir6.2 channel inhibition by adenine nucleotides. Biophys J 2003;84:266-276. [Medline]
Shyng SL, Cukras CA, Harwood J, Nichols CG. Structural determinants of PIP(2) regulation of inward rectifier K(ATP) channels. J Gen Physiol 2000;116:599-608. [Free Full Text]
Karschin C, Ecke C, Ashcroft FM, Karschin A. Overlapping distribution of K(ATP) channel-forming Kir6.2 subunit and the sulfonylurea receptor SUR1 in rodent brain. FEBS Lett 1997;401:59-64. [CrossRef][Web of Science][Medline]
Inagaki N, Gonoi T, Clement JP IV, et al. Reconstitution of IKATP: an inward rectifier subunit plus the sulfonylurea receptor. Science 1995;270:1166-1170. [Free Full Text]
Yamada K, Ji JJ, Yuan H, et al. Protective role of ATP-sensitive potassium channels in hypoxia-induced generalized seizure. Science 2001;292:1543-1546. [Free Full Text]
Hernandez-Sanchez C, Basile AS, Fedorova I, et al. Mice transgenically overexpressing sulfonylurea receptor 1 in forebrain resist seizure induction and excitotoxic neuron death. Proc Natl Acad Sci U S A 2001;98:3549-3554. [Free Full Text]
Novelli G, D'Apice MR. The strange case of the "lumper" lamin A/C gene and human premature ageing. Trends Mol Med 2003;9:370-375. [CrossRef][Web of Science][Medline]
Gloyn AL, Weedon MN, Owen KR, et al. Large-scale association studies of variants in genes encoding the pancreatic beta-cell KATP channel subunits Kir6.2 (KCNJ11) and SUR1 (ABCC8) confirm that the KCNJ11 E23K variant is associated with type 2 diabetes. Diabetes 2003;52:568-572. [Free Full Text]
Nielsen EM, Hansen L, Carstensen B, et al. The E23K variant of Kir6.2 associates with impaired post-OGTT serum insulin response and increased risk of type 2 diabetes. Diabetes 2003;52:573-577. [Free Full Text]
Miyake, A., Takahashi, S., Nakamura, Y., Inamura, K., Matsumoto, S.-i., Mochizuki, S., Katou, M.
(2009). Disruption of the Ether-a-go-go K+ Channel Gene BEC1/KCNH3 Enhances Cognitive Function. J. Neurosci.
29: 14637-14645
[Abstract][Full Text]
Rubio-Cabezas, O., Patch, A.-M., Minton, J. A. L., Flanagan, S. E., Edghill, E. L., Hussain, K., Balafrej, A., Deeb, A., Buchanan, C. R., Jefferson, I. G., Mutair, A., the Neonatal Diabetes International Collaborative, , Hattersley, A. T., Ellard, S.
(2009). Wolcott-Rallison Syndrome Is the Most Common Genetic Cause of Permanent Neonatal Diabetes in Consanguineous Families. J. Clin. Endocrinol. Metab.
94: 4162-4170
[Abstract][Full Text]
Hamming, K. S.C., Soliman, D., Matemisz, L. C., Niazi, O., Lang, Y., Gloyn, A. L., Light, P. E.
(2009). Coexpression of the Type 2 Diabetes Susceptibility Gene Variants KCNJ11 E23K and ABCC8 S1369A Alter the ATP and Sulfonylurea Sensitivities of the ATP-Sensitive K+ Channel. Diabetes
58: 2419-2424
[Abstract][Full Text]
Kline, C. F., Kurata, H. T., Hund, T. J., Cunha, S. R., Koval, O. M., Wright, P. J., Christensen, M., Anderson, M. E., Nichols, C. G., Mohler, P. J.
(2009). Dual role of KATP channel C-terminal motif in membrane targeting and metabolic regulation. Proc. Natl. Acad. Sci. USA
106: 16669-16674
[Abstract][Full Text]
Kumaraguru, J., Flanagan, S. E., Greeley, S. A. W., Nuboer, R., Stoy, J., Philipson, L. H., Hattersley, A. T., Rubio-Cabezas, O.
(2009). Tooth Discoloration in Patients With Neonatal Diabetes After Transfer Onto Glibenclamide: A previously unreported side effect. Diabetes Care
32: 1428-1430
[Abstract][Full Text]
Villareal, D. T., Koster, J. C., Robertson, H., Akrouh, A., Miyake, K., Bell, G. I., Patterson, B. W., Nichols, C. G., Polonsky, K. S.
(2009). Kir6.2 Variant E23K Increases ATP-Sensitive K+ Channel Activity and Is Associated With Impaired Insulin Release and Enhanced Insulin Sensitivity in Adults With Normal Glucose Tolerance. Diabetes
58: 1869-1878
[Abstract][Full Text]
Craig, T. J., Shimomura, K., Holl, R. W., Flanagan, S. E., Ellard, S., Ashcroft, F. M.
(2009). An In-Frame Deletion in Kir6.2 (KCNJ11) Causing Neonatal Diabetes Reveals a Site of Interaction between Kir6.2 and SUR1. J. Clin. Endocrinol. Metab.
94: 2551-2557
[Abstract][Full Text]
Taneja, T. K., Mankouri, J., Karnik, R., Kannan, S., Smith, A. J., Munsey, T., Christesen, H. B.T., Beech, D. J., Sivaprasadarao, A.
(2009). Sar1-GTPase-dependent ER exit of KATP channels revealed by a mutation causing congenital hyperinsulinism. Hum Mol Genet
18: 2400-2413
[Abstract][Full Text]
Grant, R. W., Moore, A. F., Florez, J. C.
(2009). Genetic Architecture of Type 2 Diabetes: Recent Progress and Clinical Implications. Diabetes Care
32: 1107-1114
[Full Text]
Winkler, M., Lutz, R., Russ, U., Quast, U., Bryan, J.
(2009). Analysis of Two KCNJ11 Neonatal Diabetes Mutations, V59G and V59A, and the Analogous KCNJ8 I60G Substitution: DIFFERENCES BETWEEN THE CHANNEL SUBTYPES FORMED WITH SUR1. J. Biol. Chem.
284: 6752-6762
[Abstract][Full Text]
Aaboe, K., Knop, F. K., Vilsboll, T., Volund, A., Simonsen, U., Deacon, C. F., Madsbad, S., Holst, J. J., Krarup, T.
(2009). KATP Channel Closure Ameliorates the Impaired Insulinotropic Effect of Glucose-Dependent Insulinotropic Polypeptide in Patients with Type 2 Diabetes. J. Clin. Endocrinol. Metab.
94: 603-608
[Abstract][Full Text]
Nelson, T. J, Martinez-Fernandez, A., Terzic, A.
(2009). KCNJ11 knockout morula re-engineered by stem cell diploid aggregation. Phil Trans R Soc B
364: 269-276
[Abstract][Full Text]
Monaghan, M. C., Stoy, J., Streisand, R., Philipson, L., Cogen, F. R.
(2009). Transitioning From Insulin to Glyburide in Permanent Neonatal Diabetes: Medical and Psychosocial Challenges in an 18-Year-Old Male. Clin. Diabetes
27: 25-29
[Full Text]
Palmer, N. D., Langefeld, C. D., Bryer-Ash, M., Rotter, J. I., Taylor, K. D., Bowden, D. W.
(2008). Association of the Kir6.2 E23K Variant with Reduced Acute Insulin Response in African-Americans. J. Clin. Endocrinol. Metab.
93: 4979-4983
[Abstract][Full Text]
Simkin, D., Cavanaugh, E. J., Kim, D.
(2008). Control of the single channel conductance of K2P10.1 (TREK-2) by the amino-terminus: role of alternative translation initiation. J. Physiol.
586: 5651-5663
[Abstract][Full Text]
Gajdos, Z. K. Z., Butler, J. L., Henderson, K. D., He, C., Supelak, P. J., Egyud, M., Price, A., Reich, D., Clayton, P. E., Le Marchand, L., Hunter, D. J., Henderson, B. E., Palmert, M. R., Hirschhorn, J. N.
(2008). Association Studies of Common Variants in 10 Hypogonadotropic Hypogonadism Genes with Age at Menarche. J. Clin. Endocrinol. Metab.
93: 4290-4298
[Abstract][Full Text]
McCarthy, M. I., Hattersley, A. T.
(2008). Learning From Molecular Genetics: Novel Insights Arising From the Definition of Genes for Monogenic and Type 2 Diabetes. Diabetes
57: 2889-2898
[Full Text]
Esmatjes, E., Jimenez, A., Diaz, G., Mora, M., Casamitjana, R., Perez de Nanclares, G., Castano, L., Jose Ricart, M.
(2008). Neonatal Diabetes With End-Stage Nephropathy: Pancreas transplantation decision. Diabetes Care
31: 2116-2117
[Abstract][Full Text]
McCarthy, M. I., Hirschhorn, J. N.
(2008). Genome-wide association studies: potential next steps on a genetic journey. Hum Mol Genet
17: R156-R165
[Abstract][Full Text]
Velisek, L., Veliskova, J., Chudomel, O., Poon, K.-L., Robeson, K., Marshall, B., Sharma, A., Moshe, S. L.
(2008). Metabolic Environment in Substantia Nigra Reticulata Is Critical for the Expression and Control of Hypoglycemia-Induced Seizures. J. Neurosci.
28: 9349-9362
[Abstract][Full Text]
Heitzmann, D., Warth, R.
(2008). Physiology and Pathophysiology of Potassium Channels in Gastrointestinal Epithelia. Physiol. Rev.
88: 1119-1182
[Abstract][Full Text]
Webster, N. J., Searle, G. J., Lam, P. P. L., Huang, Y.-C., Riedel, M. J., Harb, G., Gaisano, H. Y., Holt, A., Light, P. E.
(2008). Elevation in Intracellular Long-Chain Acyl-Coenzyme A Esters Lead to Reduced {beta}-Cell Excitability via Activation of Adenosine 5'-Triphosphate-Sensitive Potassium Channels. Endocrinology
149: 3679-3687
[Abstract][Full Text]
Abdulhadi-Atwan, M., Bushman, J. D., Tornovsky-Babaey, S., Perry, A., Abu-Libdeh, A., Glaser, B., Shyng, S.-L., Zangen, D. H.
(2008). Novel De Novo Mutation in Sulfonylurea Receptor 1 Presenting as Hyperinsulinism in Infancy Followed by Overt Diabetes in Early Adolescence. Diabetes
57: 1935-1940
[Abstract][Full Text]
Tarasov, A. I., Nicolson, T. J., Riveline, J.-P., Taneja, T. K., Baldwin, S. A., Baldwin, J. M., Charpentier, G., Gautier, J.-F., Froguel, P., Vaxillaire, M., Rutter, G. A.
(2008). A Rare Mutation in ABCC8/SUR1 Leading to Altered ATP-Sensitive K+ Channel Activity and {beta}-Cell Glucose Sensing Is Associated With Type 2 Diabetes in Adults. Diabetes
57: 1595-1604
[Abstract][Full Text]
Chen, R., Hussain, K., Al-Ali, M., Dattani, M. T., Hindmarsh, P., Jones, P. M., Marsh, P.
(2008). Neonatal and Late-Onset Diabetes Mellitus Caused by Failure of Pancreatic Development: Report of 4 More Cases and a Review of the Literature. Pediatrics
121: e1541-e1547
[Abstract][Full Text]
Lin, Y.-W., Bushman, J. D., Yan, F.-F., Haidar, S., MacMullen, C., Ganguly, A., Stanley, C. A., Shyng, S.-L.
(2008). Destabilization of ATP-sensitive Potassium Channel Activity by Novel KCNJ11 Mutations Identified in Congenital Hyperinsulinism. J. Biol. Chem.
283: 9146-9156
[Abstract][Full Text]
Glaser, B.
(2008). Insulin Mutations in Diabetes: The Clinical Spectrum. Diabetes
57: 799-800
[Full Text]
Edghill, E. L., Flanagan, S. E., Patch, A.-M., Boustred, C., Parrish, A., Shields, B., Shepherd, M. H., Hussain, K., Kapoor, R. R., Malecki, M., MacDonald, M. J., Stoy, J., Steiner, D. F., Philipson, L. H., Bell, G. I., the Neonatal Diabetes International Collaborative, , Hattersley, A. T., Ellard, S.
(2008). Insulin Mutation Screening in 1,044 Patients With Diabetes: Mutations in the INS Gene Are a Common Cause of Neonatal Diabetes but a Rare Cause of Diabetes Diagnosed in Childhood or Adulthood. Diabetes
57: 1034-1042
[Abstract][Full Text]
Molven, A., Ringdal, M., Nordbo, A. M., Raeder, H., Stoy, J., Lipkind, G. M., Steiner, D. F., Philipson, L. H., Bergmann, I., Aarskog, D., Undlien, D. E., Joner, G., Sovik, O., the Norwegian Childhood Diabetes Study Group, , Bell, G. I., Njolstad, P. R.
(2008). Mutations in the Insulin Gene Can Cause MODY and Autoantibody-Negative Type 1 Diabetes. Diabetes
57: 1131-1135
[Abstract][Full Text]
Koster, J. C., Cadario, F., Peruzzi, C., Colombo, C., Nichols, C. G., Barbetti, F.
(2008). The G53D Mutation in Kir6.2 (KCNJ11) Is Associated with Neonatal Diabetes and Motor Dysfunction in Adulthood that Is Improved with Sulfonylurea Therapy. J. Clin. Endocrinol. Metab.
93: 1054-1061
[Abstract][Full Text]
Rafiq, M., Flanagan, S. E., Patch, A.-M., Shields, B. M., Ellard, S., Hattersley, A. T., The Neonatal Diabetes International Collaborative,
(2008). Effective Treatment With Oral Sulfonylureas in Patients With Diabetes Due to Sulfonylurea Receptor 1 (SUR1) Mutations. Diabetes Care
31: 204-209
[Abstract][Full Text]
Shield, J. P.H., Flanagan, S. E., Mackay, D. J., Harries, L. W., Proks, P., Girard, C., Ashcroft, F. M., Temple, I. K., Ellard, S.
(2008). Mosaic Paternal Uniparental Isodisomy and an ABCC8 Gene Mutation in a Patient With Permanent Neonatal Diabetes and Hemihypertrophy. Diabetes
57: 255-258
[Abstract][Full Text]
de Wet, H., Rees, M. G., Shimomura, K., Aittoniemi, J., Patch, A.-M., Flanagan, S. E., Ellard, S., Hattersley, A. T., Sansom, M. S. P., Ashcroft, F. M.
(2007). Increased ATPase activity produced by mutations at arginine-1380 in nucleotide-binding domain 2 of ABCC8 causes neonatal diabetes. Proc. Natl. Acad. Sci. USA
104: 18988-18992
[Abstract][Full Text]
Zingman, L. V., Alekseev, A. E., Hodgson-Zingman, D. M., Terzic, A.
(2007). ATP-sensitive potassium channels: metabolic sensing and cardioprotection. J. Appl. Physiol.
103: 1888-1893
[Abstract][Full Text]
Nichols, C. G.
(2007). Alchemy in the Soup: Transforming Metabolic Signals to Excitability. Sci Signal
2007: pe59-pe59
[Abstract][Full Text]
Polak, M.
(2007). Neonatal Diabetes Mellitus: Insights for More Common Forms of Diabetes. J. Clin. Endocrinol. Metab.
92: 3774-3776
[Full Text]
Suzuki, S., Makita, Y., Mukai, T., Matsuo, K., Ueda, O., Fujieda, K.
(2007). Molecular Basis of Neonatal Diabetes in Japanese Patients. J. Clin. Endocrinol. Metab.
92: 3979-3985
[Abstract][Full Text]
Ashcroft, F. M.
(2007). ATP-sensitive K+ channels and disease: from molecule to malady. Am. J. Physiol. Endocrinol. Metab.
293: E880-E889
[Abstract][Full Text]
Cooper, E. C., Pan, Z.
(2007). Putting an end to DEND: A severe neonatal-onset epilepsy is treatable if recognized early. Neurology
69: 1310-1311
[Full Text]
Shimomura, K., Horster, F., de Wet, H., Flanagan, S. E., Ellard, S., Hattersley, A. T., Wolf, N. I., Ashcroft, F., Ebinger, F.
(2007). A novel mutation causing DEND syndrome: A treatable channelopathy of pancreas and brain. Neurology
69: 1342-1349
[Abstract][Full Text]
Stoy, J., Edghill, E. L., Flanagan, S. E., Ye, H., Paz, V. P., Pluzhnikov, A., Below, J. E., Hayes, M. G., Cox, N. J., Lipkind, G. M., Lipton, R. B., Greeley, S. A. W., Patch, A.-M., Ellard, S., Steiner, D. F., Hattersley, A. T., Philipson, L. H., Bell, G. I., Neonatal Diabetes International Collaborative Grou,
(2007). Insulin gene mutations as a cause of permanent neonatal diabetes. Proc. Natl. Acad. Sci. USA
104: 15040-15044
[Abstract][Full Text]
Bahi-Buisson, N., Eisermann, M., Nivot, S., Bellanne-Chantelot, C., Dulac, O., Bach, N., Plouin, P., Chiron, C., de Lonlay, P.
(2007). Infantile Spasms as an Epileptic Feature of DEND Syndrome Associated With an Activating Mutation in the Potassium Adenosine Triphosphate (ATP) Channel, Kir6.2. J Child Neurol
22: 1147-1150
[Abstract]
Enkvetchakul, D., Jeliazkova, I., Bhattacharyya, J., Nichols, C. G.
(2007). Control of Inward Rectifier K Channel Activity by Lipid Tethering of Cytoplasmic Domains. JGP
130: 329-334
[Abstract][Full Text]
Proks, P., Shimomura, K., Craig, T. J., Girard, C. A.J., Ashcroft, F. M.
(2007). Mechanism of action of a sulphonylurea receptor SUR1 mutation (F132L) that causes DEND syndrome. Hum Mol Genet
16: 2011-2019
[Abstract][Full Text]
Gach, A., Wyka, K., Malecki, M. T., Noczynska, A., Skupien, J., Nazim, J., Szalecki, M., Bodalski, J., Sieradzki, J., Mlynarski, W.
(2007). Islet-Specific Antibody Seroconversion in Patients With Long Duration of Permanent Neonatal Diabetes Caused by Mutations in the KCNJ11 Gene. Diabetes Care
30: 2080-2082
[Full Text]
Geng, X., Li, L., Bottino, R., Balamurugan, A. N., Bertera, S., Densmore, E., Su, A., Chang, Y., Trucco, M., Drain, P.
(2007). Antidiabetic sulfonylurea stimulates insulin secretion independently of plasma membrane KATP channels. Am. J. Physiol. Endocrinol. Metab.
293: E293-E301
[Abstract][Full Text]
Flagg, T. P., Patton, B., Masia, R., Mansfield, C., Lopatin, A. N., Yamada, K. A., Nichols, C. G.
(2007). Arrhythmia susceptibility and premature death in transgenic mice overexpressing both SUR1 and Kir6.2[{Delta}N30,K185Q] in the heart. Am. J. Physiol. Heart Circ. Physiol.
293: H836-H845
[Abstract][Full Text]
Nielsen, L. B, Ploug, K. B, Swift, P., Orskov, C., Jansen-Olesen, I., Chiarelli, F., Holst, J. J, Hougaard, P., Porksen, S., Holl, R., de Beaufort, C., Gammeltoft, S., Rorsman, P., Mortensen, H. B, Hansen, L., on behalf of the Hvidore Study Group,
(2007). Co-localisation of the Kir6.2/SUR1 channel complex with glucagon-like peptide-1 and glucose-dependent insulinotrophic polypeptide expression in human ileal cells and implications for glycaemic control in new onset type 1 diabetes. Eur J Endocrinol
156: 663-671
[Abstract][Full Text]
Vaxillaire, M., Dechaume, A., Busiah, K., Cave, H., Pereira, S., Scharfmann, R., de Nanclares, G. P., Castano, L., Froguel, P., Polak, M., and the SUR1-Neonatal Diabetes Study Group,
(2007). New ABCC8 Mutations in Relapsing Neonatal Diabetes and Clinical Features. Diabetes
56: 1737-1741
[Abstract][Full Text]
Edghill, E. L., Gloyn, A. L., Goriely, A., Harries, L. W., Flanagan, S. E., Rankin, J., Hattersley, A. T., Ellard, S.
(2007). Origin of de Novo KCNJ11 Mutations and Risk of Neonatal Diabetes for Subsequent Siblings. J. Clin. Endocrinol. Metab.
92: 1773-1777
[Abstract][Full Text]
Codner, E., Flanagan, S. E., Ugarte, F., Garcia, H., Vidal, T., Ellard, S., Hattersley, A. T.
(2007). Sulfonylurea Treatment in Young Children With Neonatal Diabetes: Dealing with hyperglycemia, hypoglycemia, and sick days. Diabetes Care
30: e28-e29
[Full Text]
Masia, R., De Leon, D. D., MacMullen, C., McKnight, H., Stanley, C. A., Nichols, C. G.
(2007). A Mutation in the TMD0-L0 Region of Sulfonylurea Receptor-1 (L225P) Causes Permanent Neonatal Diabetes Mellitus (PNDM). Diabetes
56: 1357-1362
[Abstract][Full Text]
Stanik, J., Gasperikova, D., Paskova, M., Barak, L., Javorkova, J., Jancova, E., Ciljakova, M., Hlava, P., Michalek, J., Flanagan, S. E., Pearson, E., Hattersley, A. T., Ellard, S., Klimes, I.
(2007). Prevalence of Permanent Neonatal Diabetes in Slovakia and Successful Replacement of Insulin with Sulfonylurea Therapy in KCNJ11 and ABCC8 Mutation Carriers. J. Clin. Endocrinol. Metab.
92: 1276-1282
[Abstract][Full Text]
Masia, R., Koster, J. C., Tumini, S., Chiarelli, F., Colombo, C., Nichols, C. G., Barbetti, F.
(2007). An ATP-Binding Mutation (G334D) in KCNJ11 Is Associated With a Sulfonylurea-Insensitive Form of Developmental Delay, Epilepsy, and Neonatal Diabetes. Diabetes
56: 328-336
[Abstract][Full Text]
Florez, J. C., Jablonski, K. A., Kahn, S. E., Franks, P. W., Dabelea, D., Hamman, R. F., Knowler, W. C., Nathan, D. M., Altshuler, D., for the Diabetes Prevention Program Research Group,
(2007). Type 2 Diabetes-Associated Missense Polymorphisms KCNJ11 E23K and ABCC8 A1369S Influence Progression to Diabetes and Response to Interventions in the Diabetes Prevention Program. Diabetes
56: 531-536
[Abstract][Full Text]
Malecki, M. T., Skupien, J., Klupa, T., Wanic, K., Mlynarski, W., Gach, A., Solecka, I., Sieradzki, J.
(2007). Transfer to Sulphonylurea Therapy in Adult Subjects With Permanent Neonatal Diabetes Due to KCNJ11-Activating Mutations: Evidence for improvement in insulin sensitivity. Diabetes Care
30: 147-149
[Full Text]
Yamada, S., Kane, G. C., Behfar, A., Liu, X.-K., Dyer, R. B., Faustino, R. S., Miki, T., Seino, S., Terzic, A.
(2006). Protection conferred by myocardial ATP-sensitive K+ channels in pressure overload-induced congestive heart failure revealed in KCNJ11 Kir6.2-null mutant. J. Physiol.
577: 1053-1065
[Abstract][Full Text]
Roden, D. M., Altman, R. B., Benowitz, N. L., Flockhart, D. A., Giacomini, K. M., Johnson, J. A., Krauss, R. M., McLeod, H. L., Ratain, M. J., Relling, M. V., Ring, H. Z., Shuldiner, A. R., Weinshilboum, R. M., Weiss, S. T., for the Pharmacogenetics Research Network,
(2006). Pharmacogenomics: Challenges and Opportunities.. ANN INTERN MED
145: 749-757
[Abstract][Full Text]
Koster, J. C., Remedi, M. S., Masia, R., Patton, B., Tong, A., Nichols, C. G.
(2006). Expression of ATP-Insensitive KATP Channels in Pancreatic {beta}-Cells Underlies a Spectrum of Diabetic Phenotypes. Diabetes
55: 2957-2964
[Abstract][Full Text]
Tarasov, A. I., Welters, H. J., Senkel, S., Ryffel, G. U., Hattersley, A. T., Morgan, N. G., Ashcroft, F. M.
(2006). A Kir6.2 Mutation Causing Neonatal Diabetes Impairs Electrical Activity and Insulin Secretion From INS-1 {beta}-Cells. Diabetes
55: 3075-3082
[Abstract][Full Text]
Bonnycastle, L. L., Willer, C. J., Conneely, K. N., Jackson, A. U., Burrill, C. P., Watanabe, R. M., Chines, P. S., Narisu, N., Scott, L. J., Enloe, S. T., Swift, A. J., Duren, W. L., Stringham, H. M., Erdos, M. R., Riebow, N. L., Buchanan, T. A., Valle, T. T., Tuomilehto, J., Bergman, R. N., Mohlke, K. L., Boehnke, M., Collins, F. S.
(2006). Common Variants in Maturity-Onset Diabetes of the Young Genes Contribute to Risk of Type 2 Diabetes in Finns. Diabetes
55: 2534-2540
[Abstract][Full Text]
Groves, C. J., Zeggini, E., Minton, J., Frayling, T. M., Weedon, M. N., Rayner, N. W., Hitman, G. A., Walker, M., Wiltshire, S., Hattersley, A. T., McCarthy, M. I.
(2006). Association Analysis of 6,736 U.K. Subjects Provides Replication and Confirms TCF7L2 as a Type 2 Diabetes Susceptibility Gene With a Substantial Effect on Individual Risk. Diabetes
55: 2640-2644
[Abstract][Full Text]
Babenko, A. P., Polak, M., Cave, H., Busiah, K., Czernichow, P., Scharfmann, R., Bryan, J., Aguilar-Bryan, L., Vaxillaire, M., Froguel, P.
(2006). Activating mutations in the ABCC8 gene in neonatal diabetes mellitus.. NEJM
355: 456-466
[Abstract][Full Text]
Pearson, E. R., Flechtner, I., Njolstad, P. R., Malecki, M. T., Flanagan, S. E., Larkin, B., Ashcroft, F. M., Klimes, I., Codner, E., Iotova, V., Slingerland, A. S., Shield, J., Robert, J.-J., Holst, J. J., Clark, P. M., Ellard, S., Sovik, O., Polak, M., Hattersley, A. T., the Neonatal Diabetes International Collaborative,
(2006). Switching from insulin to oral sulfonylureas in patients with diabetes due to Kir6.2 mutations.. NEJM
355: 467-477
[Abstract][Full Text]
Sperling, M. A.
(2006). ATP-sensitive potassium channels--neonatal diabetes mellitus and beyond.. NEJM
355: 507-510
[Full Text]
Kane, G. C., Behfar, A., Dyer, R. B., O'Cochlain, D. F., Liu, X.-K., Hodgson, D. M., Reyes, S., Miki, T., Seino, S., Terzic, A.
(2006). KCNJ11 gene knockout of the Kir6.2 KATP channel causes maladaptive remodeling and heart failure in hypertension. Hum Mol Genet
15: 2285-2297
[Abstract][Full Text]
Gloyn, A. L., Mackay, D. J.G., Weedon, M. N., McCarthy, M. I., Walker, M., Hitman, G., Knight, B. A., Owen, K. R., Hattersley, A. T., Frayling, T. M.
(2006). Assessment of the Role of Common Genetic Variation in the Transient Neonatal Diabetes Mellitus (TNDM) Region in Type 2 Diabetes: A Comparative Genomic and Tagging Single Nucleotide Polymorphism Approach.. Diabetes
55: 2272-2276
[Abstract][Full Text]
Yokoi, N., Kanamori, M., Horikawa, Y., Takeda, J., Sanke, T., Furuta, H., Nanjo, K., Mori, H., Kasuga, M., Hara, K., Kadowaki, T., Tanizawa, Y., Oka, Y., Iwami, Y., Ohgawara, H., Yamada, Y., Seino, Y., Yano, H., Cox, N. J., Seino, S.
(2006). Association Studies of Variants in the Genes Involved in Pancreatic {beta}-Cell Function in Type 2 Diabetes in Japanese Subjects.. Diabetes
55: 2379-2386
[Abstract][Full Text]
Slingerland, A. S., Hattersley, A. T.
(2006). Activating Mutations in the Gene Encoding Kir6.2 Alter Fetal and Postnatal Growth and Also Cause Neonatal Diabetes. J. Clin. Endocrinol. Metab.
91: 2782-2788
[Abstract][Full Text]
Hathout, E., Mace, J., Bell, G. I., Njolstad, P. R.
(2006). Treatment of Hyperglycemia in a 7-Year-Old Child Diagnosed With Neonatal Diabetes.. Diabetes Care
29: 1458-1458
[Full Text]
Sesti, G., Laratta, E., Cardellini, M., Andreozzi, F., Del Guerra, S., Irace, C., Gnasso, A., Grupillo, M., Lauro, R., Hribal, M. L., Perticone, F., Marchetti, P.
(2006). The E23K Variant of KCNJ11 Encoding the Pancreatic {beta}-Cell Adenosine 5'-Triphosphate-Sensitive Potassium Channel Subunit Kir6.2 Is Associated with an Increased Risk of Secondary Failure to Sulfonylurea in Patients with Type 2 Diabetes. J. Clin. Endocrinol. Metab.
91: 2334-2339
[Abstract][Full Text]
Proks, P., Arnold, A. L., Bruining, J., Girard, C., Flanagan, S. E., Larkin, B., Colclough, K., Hattersley, A. T., Ashcroft, F. M., Ellard, S.
(2006). A heterozygous activating mutation in the sulphonylurea receptor SUR1 (ABCC8) causes neonatal diabetes. Hum Mol Genet
15: 1793-1800
[Abstract][Full Text]
Shimomura, K., Girard, C. A.J., Proks, P., Nazim, J., Lippiat, J. D., Cerutti, F., Lorini, R., Ellard, S., Hattersley, A. T., Barbetti, F., Ashcroft, F. M.
(2006). Mutations at the Same Residue (R50) of Kir6.2 (KCNJ11) That Cause Neonatal Diabetes Produce Different Functional Effects. Diabetes
55: 1705-1712
[Abstract][Full Text]
Proks, P., Girard, C., Baevre, H., Njolstad, P. R., Ashcroft, F. M.
(2006). Functional Effects of Mutations at F35 in the NH2-terminus of Kir6.2 (KCNJ11), Causing Neonatal Diabetes, and Response to Sulfonylurea Therapy. Diabetes
55: 1731-1737
[Abstract][Full Text]
Lin, C.-W., Lin, Y.-W., Yan, F.-F., Casey, J., Kochhar, M., Pratt, E. B., Shyng, S.-L.
(2006). Kir6.2 Mutations Associated With Neonatal Diabetes Reduce Expression of ATP-Sensitive K+ channels: Implications in Disease Mechanism and Sulfonylurea Therapy. Diabetes
55: 1738-1746
[Abstract][Full Text]
Edghill, E. L., Dix, R. J., Flanagan, S. E., Bingley, P. J., Hattersley, A. T., Ellard, S., Gillespie, K. M.
(2006). HLA Genotyping Supports a Nonautoimmune Etiology in Patients Diagnosed With Diabetes Under the Age of 6 Months. Diabetes
55: 1895-1898
[Abstract][Full Text]
Hattersley, A. T., Pearson, E. R.
(2006). Minireview: Pharmacogenetics and Beyond: The Interaction of Therapeutic Response, {beta}-Cell Physiology, and Genetics in Diabetes. Endocrinology
147: 2657-2663
[Abstract][Full Text]
Tammaro, P., Proks, P., Ashcroft, F. M.
(2006). Functional effects of naturally occurring KCNJ11 mutations causing neonatal diabetes on cloned cardiac KATP channels. J. Physiol.
571: 3-14
[Abstract][Full Text]
Kubo, Y., Adelman, J. P., Clapham, D. E., Jan, L. Y., Karschin, A., Kurachi, Y., Lazdunski, M., Nichols, C. G., Seino, S., Vandenberg, C. A.
(2005). International Union of Pharmacology. LIV. Nomenclature and Molecular Relationships of Inwardly Rectifying Potassium Channels. Pharmacol. Rev.
57: 509-526
[Full Text]
Porter, J R, Barrett, T G
(2005). Monogenic syndromes of abnormal glucose homeostasis: clinical review and relevance to the understanding of the pathology of insulin resistance and {beta} cell failure. J. Med. Genet.
42: 893-902
[Abstract][Full Text]
Koster, J. C., Permutt, M. A., Nichols, C. G.
(2005). Diabetes and Insulin Secretion: The ATP-Sensitive K+ Channel (KATP) Connection. Diabetes
54: 3065-3072
[Abstract][Full Text]
D'Amato, E., Lorini, R.
(2005). Letter re: Neonatal Diabetes Mellitus and Mutation in the HNF-1{beta} Gene. J. Clin. Endocrinol. Metab.
90: 5906-5907
[Full Text]
Lin, C.-W., Yan, F., Shimamura, S., Barg, S., Shyng, S.-L.
(2005). Membrane Phosphoinositides Control Insulin Secretion Through Their Effects on ATP-Sensitive K+ Channel Activity. Diabetes
54: 2852-2858
[Abstract][Full Text]
Remedi, M. S., Koster, J. C., Patton, B. L., Nichols, C. G.
(2005). ATP-Sensitive K+ Channel Signaling in Glucokinase-Deficient Diabetes. Diabetes
54: 2925-2931
[Abstract][Full Text]
Proks, P., Girard, C., Ashcroft, F. M.
(2005). Functional effects of KCNJ11 mutations causing neonatal diabetes: enhanced activation by MgATP. Hum Mol Genet
14: 2717-2726
[Abstract][Full Text]
Hattersley, A. T., Ashcroft, F. M.
(2005). Activating Mutations in Kir6.2 and Neonatal Diabetes: New Clinical Syndromes, New Scientific Insights, and New Therapy. Diabetes
54: 2503-2513
[Abstract][Full Text]
Koster, J. C., Remedi, M. S., Dao, C., Nichols, C. G.
(2005). ATP and Sulfonylurea Sensitivity of Mutant ATP-Sensitive K+ Channels in Neonatal Diabetes: Implications for Pharmacogenomic Therapy. Diabetes
54: 2645-2654
[Abstract][Full Text]
Li, L., Geng, X., Yonkunas, M., Su, A., Densmore, E., Tang, P., Drain, P.
(2005). Ligand-dependent Linkage of the ATP Site to Inhibition Gate Closure in the KATP Channel. JGP
126: 285-299
[Abstract][Full Text]
Yorifuji, T., Nagashima, K., Kurokawa, K., Kawai, M., Oishi, M., Akazawa, Y., Hosokawa, M., Yamada, Y., Inagaki, N., Nakahata, T.
(2005). The C42R Mutation in the Kir6.2 (KCNJ11) Gene as a Cause of Transient Neonatal Diabetes, Childhood Diabetes, or Later-Onset, Apparently Type 2 Diabetes Mellitus. J. Clin. Endocrinol. Metab.
90: 3174-3178
[Abstract][Full Text]
Hansen, S. K., Nielsen, E.-M. D., Ek, J., Andersen, G., Glumer, C., Carstensen, B., Mouritzen, P., Drivsholm, T., Borch-Johnsen, K., Jorgensen, T., Hansen, T., Pedersen, O.
(2005). Analysis of Separate and Combined Effects of Common Variation in KCNJ11 and PPARG on Risk of Type 2 Diabetes. J. Clin. Endocrinol. Metab.
90: 3629-3637
[Abstract][Full Text]
Gloyn, A. L., Reimann, F., Girard, C., Edghill, E. L., Proks, P., Pearson, E. R., Temple, I. K., Mackay, D. J.G., Shield, J. P.H., Freedenberg, D., Noyes, K., Ellard, S., Ashcroft, F. M., Gribble, F. M., Hattersley, A. T.
(2005). Relapsing diabetes can result from moderately activating mutations in KCNJ11. Hum Mol Genet
14: 925-934
[Abstract][Full Text]
Meyre, D., Boutin, P., Tounian, A., Deweirder, M., Aout, M., Jouret, B., Heude, B., Weill, J., Tauber, M., Tounian, P., Froguel, P.
(2005). Is Glutamate Decarboxylase 2 (GAD2) a Genetic Link between Low Birth Weight and Subsequent Development of Obesity in Children?. J. Clin. Endocrinol. Metab.
90: 2384-2390
[Abstract][Full Text]
Codner, E., Flanagan, S., Ellard, S., Garcia, H., Hattersley, A. T.
(2005). High-Dose Glibenclamide Can Replace Insulin Therapy Despite Transitory Diarrhea in Early-Onset Diabetes Caused by a Novel R201L Kir6.2 Mutation. Diabetes Care
28: 758-759
[Full Text]
Proks, P., Antcliff, J. F., Lippiat, J., Gloyn, A. L., Hattersley, A. T., Ashcroft, F. M.
(2004). Molecular basis of Kir6.2 mutations associated with neonatal diabetes or neonatal diabetes plus neurological features. Proc. Natl. Acad. Sci. USA
101: 17539-17544
[Abstract][Full Text]
Porter, J R, Barrett, T G
(2004). Acquired non-type 1 diabetes in childhood: subtypes, diagnosis, and management. Arch. Dis. Child.
89: 1138-1144
[Abstract][Full Text]
Bryan, J., Vila-Carriles, W. H., Zhao, G., Babenko, A. P., Aguilar-Bryan, L.
(2004). Toward Linking Structure With Function in ATP-Sensitive K+ Channels. Diabetes
53: S104-S112
[Abstract][Full Text]
Tarasov, A., Dusonchet, J., Ashcroft, F.
(2004). Metabolic Regulation of the Pancreatic Beta-Cell ATP-Sensitive K+ Channel: A Pas de Deux. Diabetes
53: S113-S122
[Abstract][Full Text]
Thomas, H., Senkel, S., Erdmann, S., Arndt, T., Turan, G., Klein-Hitpass, L., Ryffel, G. U.
(2004). Pattern of genes influenced by conditional expression of the transcription factors HNF6, HNF4{alpha} and HNF1{beta} in a pancreatic {beta}-cell line. Nucleic Acids Res
32: e150-e150
[Abstract][Full Text]