The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
A correction has been published: N Engl J Med 2004;351(14):1470.

Original Article
PreviousPrevious
Volume 350:1838-1849 April 29, 2004 Number 18
NextNext

Activating Mutations in the Gene Encoding the ATP-Sensitive Potassium-Channel Subunit Kir6.2 and Permanent Neonatal Diabetes
Anna L. Gloyn, D.Phil., Ewan R. Pearson, M.R.C.P., Jennifer F. Antcliff, B.Sc., Peter Proks, D.Phil., G. Jan Bruining, M.D., Annabelle S. Slingerland, M.D., Neville Howard, M.D., F.R.A.C.P., Shubha Srinivasan, M.B., B.S., M.R.C.P., José M.C.L. Silva, M.D., Janne Molnes, M.Sc., Emma L. Edghill, M.Sc., Timothy M. Frayling, Ph.D., I. Karen Temple, F.R.C.P., Deborah Mackay, Ph.D., Julian P.H. Shield, M.D., F.R.C.P.C.H., Zdenek Sumnik, M.D., Adrian van Rhijn, M.D., Jerry K.H. Wales, D.M., F.R.C.P.C.H., Penelope Clark, Ph.D., F.R.C.Path., Shaun Gorman, M.R.C.P., Javier Aisenberg, M.D., Sian Ellard, Ph.D., M.R.C.Path., Pål R. Njølstad, M.D., Ph.D., Frances M. Ashcroft, Ph.D., and Andrew T. Hattersley, D.M., F.R.C.P.

 

This Article
-Abstract
- PDF
-PDA Full Text
-PowerPoint Slide Set
-Supplementary Material

Commentary
-Perspective
 by Gribble, F. M.

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited
-E-mail When Letters Appear

More Information
-Related Article
-PubMed Citation
ABSTRACT

Background Patients with permanent neonatal diabetes usually present within the first three months of life and require insulin treatment. In most, the cause is unknown. Because ATP-sensitive potassium (KATP) channels mediate glucose-stimulated insulin secretion from the pancreatic beta cells, we hypothesized that activating mutations in the gene encoding the Kir6.2 subunit of this channel (KCNJ11) cause neonatal diabetes.

Methods We sequenced the KCNJ11 gene in 29 patients with permanent neonatal diabetes. The insulin secretory response to intravenous glucagon, glucose, and the sulfonylurea tolbutamide was assessed in patients who had mutations in the gene.

Results Six novel, heterozygous missense mutations were identified in 10 of the 29 patients. In two patients the diabetes was familial, and in eight it arose from a spontaneous mutation. Their neonatal diabetes was characterized by ketoacidosis or marked hyperglycemia and was treated with insulin. Patients did not secrete insulin in response to glucose or glucagon but did secrete insulin in response to tolbutamide. Four of the patients also had severe developmental delay and muscle weakness; three of them also had epilepsy and mild dysmorphic features. When the most common mutation in Kir6.2 was coexpressed with sulfonylurea receptor 1 in Xenopus laevis oocytes, the ability of ATP to block mutant KATP channels was greatly reduced.

Conclusions Heterozygous activating mutations in the gene encoding Kir6.2 cause permanent neonatal diabetes and may also be associated with developmental delay, muscle weakness, and epilepsy. Identification of the genetic cause of permanent neonatal diabetes may facilitate the treatment of this disease with sulfonylureas.


Neonatal diabetes may be defined as insulin-requiring hyperglycemia that is diagnosed within the first three months of life. It may be either transient, resolving within a median of three months, or permanent, in which case insulin treatment is required for life.1 Substantial progress has been made in our understanding of transient neonatal diabetes, with the majority of cases being attributable to an abnormality in an imprinted region of chromosome 6.2 In most patients, the cause of permanent neonatal diabetes is unknown; homozygous and compound heterozygous mutations in the gene encoding glucokinase account for a minority of cases,3,4,5,6 and the genes for some very rare, multisystem conditions that include neonatal diabetes have been identified.7,8,9

ATP-sensitive potassium (KATP) channels play a central role in glucose-stimulated insulin secretion from pancreatic beta cells: insulin secretion is initiated by closure of the channels and inhibited by their opening (Figure 1).10 The beta-cell KATP channel is an octameric complex of four pore-forming, inwardly rectifying potassium-channel subunits (Kir6.2) and four regulatory sulfonylurea-receptor subunits (SUR1).11 Both Kir6.2 and SUR1 are required for correct metabolic regulation of the channel: ATP closes the channel by binding to Kir6.2, and magnesium nucleotides (Mg-ADP and Mg-ATP) stimulate channel activity by interacting with SUR1. Sulfonylureas stimulate insulin secretion in type 2 diabetes by binding to SUR1 and closing KATP channels by an ATP-independent mechanism.10


View larger version (44K):
[in this window]
[in a new window]
 
Figure 1. Schematic Representation of the Pancreatic Beta Cell, Illustrating the Role of the ATP-Sensitive Potassium (KATP) Channel in Insulin Secretion.

Glucose enters the beta cell by way of the GLUT2 glucose transporter. Once inside the cell, glucose is metabolized, leading to changes in the intracellular concentration of adenine nucleotides that inhibit the KATP channel and thus cause channel closure. The KATP channel consists of four sulfonylurea-receptor (SUR1) subunits and four Kir6.2 subunits in an octomeric structure. Channel closure leads to membrane depolarization, which subsequently activates voltage-dependent calcium (Ca2+) channels, leading in turn to an increase in intracellular Ca2+, which triggers insulin exocytosis. Sulfonylureas initiate secretion by directly binding to the SUR1 subunits of KATP channels and causing channel closure. Mg-ADP denotes magnesium ADP.

 
We hypothesized that activating mutations in the gene encoding the Kir6.2 subunit of the beta-cell KATP channel (KCNJ11) cause monogenic diabetes, because inactivating mutations in this gene lead to uncontrolled insulin secretion and congenital hyperinsulinism.12 The contrasting phenotypes of permanent neonatal diabetes and hyperinsulinism are seen with inactivating and activating mutations, respectively, of the gene encoding glucokinase.3,13,14 Strong support for our hypothesis comes from the observation that transgenic mice with overactive beta-cell KATP channels have profound neonatal diabetes.15 We therefore sequenced the gene encoding Kir6.2 in patients who had permanent neonatal diabetes or dominantly inherited maturity-onset diabetes of the young (MODY).

Methods

Patients

We sequenced the DNA of 29 probands with permanent neonatal diabetes, mainly from the International Society for Pediatric and Adolescent Diabetes (ISPAD) Rare Diabetes Collection. Patients were registered in the collection or were recruited for the study between September 2001 and October 2003. Patients with abnormalities in chromosome 6q24, mutations in the gene encoding glucokinase, exocrine pancreatic insufficiency, and pancreatic agenesis were excluded. We also sequenced the DNA of 15 probands with MODY from families in the United Kingdom in whom mutations in the six known MODY-associated genes had been ruled out.16 Written informed consent was obtained from all the patients or their parents.

Mutational Analyses

The coding region and the intron–exon boundaries of KCNJ11 were amplified from genomic DNA by the polymerase chain reaction with the use of previously described primers17 in addition to fragment 5R 5'CTGTGGTCCTCATCAAGCTG3', fragment 6F 5'GCTGAGGAGGACGGACGTTAC3', and fragment 6R 5'CCACATGGTCCGTGTGTACACACG3'. The products were sequenced by standard methods. Family relationships were confirmed with the use of a panel of 10 microsatellite markers.

Clinical Studies

All patients with mutations in the gene encoding Kir6.2 underwent clinical examinations, including detailed developmental and neurologic assessments by a consultant pediatrician or physician, and their medical records were reviewed. Electrocardiograms were examined for evidence of arrhythmias and for measurement of the QT interval. All physiological tests were performed after the patients had fasted overnight. A glucagon stimulation test was performed as follows: 15 µg of glucagon per kilogram of body weight (maximal dose, 1 mg) was given intravenously at time 0, and blood samples for measurement of C-peptide were obtained at –10, –5, 0, 2, 4, 6, 8, 10, 15, and 20 minutes. The highest C-peptide value was then recorded. A tolbutamide-modified, frequently sampled intravenous glucose-tolerance test was performed as previously described.18 After base-line sampling, a bolus of 0.3 g of glucose per kilogram was given intravenously, followed by a bolus of 3 mg of tolbutamide per kilogram 20 minutes later. We calculated the peak incremental insulin response after the glucose bolus and after the tolbutamide bolus.

Functional Studies

Wild-type mouse Kir6.2 or Kir6.2 in which histidine replaced arginine at position 201 (R201H) was coexpressed with rat SUR1 (containing exon 17) in Xenopus laevis oocytes, and KATP currents were recorded as previously described.19,20 To simulate the effect of heterozygosity, we injected oocytes with SUR1 and a 1:1 mixture of Kir6.2 and Kir6.2-R201H messenger RNA (mRNA). ATP concentration–response curves were fitted according to the Hill equation: I ÷ IC = 1 ÷ [1 + ([ATP] ÷ IC50)h], where I is the KATP current, IC is the current in the absence of nucleotide, [ATP] is the ATP concentration, IC50 is the ATP concentration at which inhibition is half maximal, and h is the Hill coefficient. Data are given as means ±SE.

Results

Mutational Analyses

We identified six novel, heterozygous mutations in the gene encoding Kir6.2 in 10 of the 29 probands who had permanent neonatal diabetes. The mutations were a glutamine-to-arginine substitution at position 52 (Q52R), a valine-to-glycine substitution at position 59 (V59G), a valine-to-methionine substitution at position 59 (V59M), an arginine-to-histidine substitution at position 201 (R201H), an arginine-to-cysteine substitution at position 201 (R201C), and an isoleucine-to-leucine substitution at position 296 (I296L). No mutations were found in any of the probands who had MODY. The R201H missense mutation was identified in 4 of these 10 probands, and the V59M missense mutation was detected in 2. In all the families, neonatal diabetes was seen only in persons who had Kir6.2 mutations, and all family members who did not have these mutations were not diabetic (Figure 2).


View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Diabetes Status and Mutations in the Gene Encoding Kir6.2 in 10 Families.

These partial pedigrees show families with the Q52R, V59G, V59M, R201C, R201H, and I296L mutations. In all the pedigrees for which parental DNA was available, family relationships were confirmed by a panel of 10 microsatellites. In ISPAD pedigrees 19, 22, 27, 41, 43, 44, 54, and 55, spontaneous mutations explain the absence of permanent neonatal diabetes in the parents and its presence in a child. Squares represent male family members, circles female family members, and diamonds sex not defined; blue circles and squares represent persons with neonatal diabetes; a slash mark indicates deceased. The numbers inside diamonds indicate the number of unaffected siblings. A two-letter code for allele status is shown underneath each symbol: N denotes no mutation, M mutation, and NA not available for testing. P and an arrow denote the proband in each family (the first affected member recruited for this study). Amino acids are denoted by their single-letter codes.

 
In two families (ISPAD 19 and BR 1), neonatal diabetes had been transmitted from an affected parent to his or her offspring. Because both maternal and paternal transmission can occur, imprinting of this locus is unlikely. In nine cases, DNA was available from both unaffected parents, and paternity was established; the mutations were shown to have arisen spontaneously. None of the mutations were present in 100 nondiabetic subjects from the United Kingdom.

Figure 3 shows the location of mutated residues in Kir6.2. All the mutated residues are conserved among humans, rats, mice, and bullfrogs. The arginine residue at position 201 is conserved among 10 members of the family of Kir channels, a finding that supports the possibility that this residue has a critical role in channel function. In addition, we identified several previously recognized polymorphisms (a glutamic acid–to–lysine substitution at position 23 [E23K], a silent alanine-to-alanine substitution at position 190 [A190A], a silent leucine-to-leucine substitution at position 267 [L267L], a leucine-to-valine substitution at position 270 [L270V], an isoleucine-to-valine substitution at position 337 (I337V], a silent lysine-to-lysine substitution at position 381 [K381K], and a serine-to-cysteine substitution at position 385 [S385C]).


View larger version (51K):
[in this window]
[in a new window]
 
Figure 3. Illustration of Two Kir6.2 Subunits, Showing the Mutations Identified in Patients with Permanent Neonatal Diabetes.

The illustration is based on the crystal structure of the potassium channel KirBac1.1.21 The alpha-helical slide helix is shown in green, the selectivity filter in orange, and the C-terminal beta sheets in blue. The residues affected by mutations in patients with neonatal diabetes (Q52, V59, R201, and I296) are shown in yellow. Amino acids are denoted by their single-letter codes. The shaded band represents the cell membrane, and the blue circles the potassium ion. The labels "External" and "Internal" refer to areas outside and inside the cell.

 
Clinical Characteristics

The clinical characteristics of patients with mutations are shown in Table 1. There were two subgroups of patients: those who had only diabetes and those who had diabetes and shared neurologic abnormalities. Diabetes and low birth weight reflect impaired intrauterine and postnatal insulin secretion and were similar in the two subgroups of patients.

View this table:
[in this window]
[in a new window]
 
Table 1. Clinical Characteristics of Patients with Mutant Kir6.2.

 
            Diabetes

Diabetes was diagnosed at a mean age of 7 weeks (range, birth to 26 weeks). At diagnosis, all the patients had marked hyperglycemia (glucose concentration, 270 to 972 mg per deciliter [15 to 54 mmol per liter]), and three had ketoacidosis. None of the patients had elevated concentrations of autoantibodies associated with type 1 diabetes, and the C-peptide concentration was usually less than 200 pmol per liter. The median dose of insulin was 0.8 U per kilogram (range, 0.3 to 1.3). Only one patient (the proband's father in family BR 1) was not treated with insulin. He had received tolbutamide since childhood, and at 46 years of age, he had good control of the disease with this medication (fasting glucose concentration, 110 mg per deciliter [6.1 mmol per liter]; C-peptide concentration, 400 pmol per liter).

            Low Birth Weight

Low birth weight was a feature of all the patients; in 7 of 12 (58 percent) the birth weight was at or below the 3rd percentile. Patients who did not have neurologic symptoms (Table 1) showed marked catch-up growth after birth, and their weights and heights were normally distributed on follow-up after a mean of 9.3 years.

            Neurologic Features

Three of the patients (the probands in families ISPAD 25, ISPAD 27, and ISPAD 43) had very similar neurologic abnormalities, which suggested extrapancreatic phenotypes associated with their Kir6.2 mutation (Table 1). All three had marked developmental delay, muscle weakness, epilepsy, and dysmorphic features as well as neonatal diabetes. Another patient (the proband in family ISPAD 55) had an intermediate phenotype involving severe developmental delay and muscle weakness in addition to neonatal diabetes, but no other neurologic features. No cause other than their Kir6.2 mutation was found for their neurologic problems. All children had normal karyotypes. The other patients had normal development, indicating that not all mutations in Kir6.2 are associated with neurologic abnormalities.

            Developmental Delay

All four patients with common neurologic features had marked developmental delay involving failure to achieve motor, intellectual, and social milestones appropriate for their age. The motor delay was the most marked of these features; the oldest child was unable to walk unaided at the age of 17 years, and all four children showed motor development that was consistent with that of children half their chronologic age or younger. There was muscular weakness on neurologic examination in all four cases. The creatine kinase concentration was normal in all of them. Muscle-biopsy specimens obtained from two of the patients were normal, and electromyography performed in two confirmed that nerve conduction was normal. In one patient action potentials of decreased duration and amplitude suggested a myopathy.

Social and language development was also markedly delayed in these four patients. None of them had microcephaly, and magnetic resonance imaging (MRI) and computed tomographic studies showed no reduction in the size of the cortex or cerebellum. No structural abnormalities were seen, apart from small, nonspecific, generalized patches throughout the white matter in one patient (the proband in family ISPAD 43) on an MRI scan obtained when she was 14 years of age.

            Epilepsy

Generalized seizures, either complex or myoclonic, were observed in three patients (the probands in families ISPAD 25, ISPAD 27, and ISPAD 43) beginning in the first year of life. The seizures responded to antiepileptic medication (vigabatrin in two patients and sodium valproate in one). The seizures preceded clinically recognized episodes of hypoglycemia. All electroencephalograms showed generalized abnormal activity with bilateral sharp waves. One patient had marked hypsarrhythmia, which responded to vigabatrin.

            Dysmorphic Features

All three patients with epilepsy had mild dysmorphic features (see Supplementary Appendix 1, available with the full text of this article at www.nejm.org). Their appearance was characterized by a prominent metopic suture, a downturned mouth, and bilateral ptosis. All three patients had limb contractures, which were diagnosed at birth in two and at four years of age in one.

Physiological Studies

Both during fasting and after glucagon stimulation, the serum C-peptide concentration was generally less than 200 pmol per liter, despite marked hyperglycemia — a finding consistent with profound beta-cell dysfunction (Table 1). Serum C-peptide exceeded the lower limit of the normal range in only three patients (two insulin-treated children and the adult whose diabetes was well controlled with tolbutamide) (Table 1). Three patients, who had mutations affecting residue 201, had only minimal insulin secretion in response to intravenous glucose but did secrete insulin in response to tolbutamide (Figure 4).


View larger version (5K):
[in this window]
[in a new window]
 
Figure 4. Insulin Secretory Responses to Intravenous Glucose and to Tolbutamide.

The results are presented as the peak increase in the insulin level from base line in response to 0.3 g of intravenous glucose per kilogram and 3 mg of intravenous tolbutamide per kilogram for three members of ISPAD families 19 and 41.

 
Functional Analysis of the R201H Mutation

When wild-type Kir6.2 was coexpressed with SUR1 in X. laevis oocytes, KATP currents were almost undetectable because of inhibition by high intracellular ATP concentrations, but they could be activated by azide, which lowers cytosolic ATP concentrations (Figure 5A). In contrast, significant resting currents were recorded from oocytes expressing Kir6.2-R201H–SUR1 (P<0.01 for the comparison with wild-type Kir6.2). These currents were further activated by azide (P<0.05 for the comparison with wild-type Kir6.2) and were blocked by tolbutamide, indicating that they flow through KATP channels (Figure 5B and Figure 5C). These data suggest that metabolism causes less blockade of Kir6.2-R201H–SUR1 channels than it does of wild-type KATP channels.


View larger version (17K):
[in this window]
[in a new window]
 
Figure 5. The Effects of Metabolic Inhibition, a Sulfonylurea, and Intracellular ATP on Currents in Wild-Type and Mutant ATP-Sensitive Potassium (KATP) Channels.

Whole-cell currents were recorded in a two-electrode voltage clamp from intact oocytes expressing Kir6.2–SUR1 (Panel A) or Kir6.2-R201H–SUR1 (Panel B) in response to voltage steps of ±20 mV from a holding potential of –10 mV. The external solution consisted of 90 mM potassium chloride, 1 mM magnesium chloride, 1.8 mM calcium chloride, and 5 mM HEPES (pH 7.4 with potassium hydroxide), plus 3 mM azide and 500 µM tolbutamide as indicated. Panel C shows the mean whole-cell current evoked by a voltage step from –10 to –30 mV in control solution, then after steady state was reached with 3 mM azide, then in the continued presence of azide plus 500 µM tolbutamide. Oocytes were injected with messenger RNA encoding SUR1 plus either Kir6.2 (six oocytes), Kir6.2-R201H (seven), or a 1:1 mixture of Kir6.2 and Kir6.2-R201H (seven). The T bars represent standard errors. Panel D shows the KATP current recorded in response to voltage ramps from –110 to +100 mV from an inside-out patch excised from an X. laevis oocyte coexpressing SUR1 and either wild-type or mutant Kir6.2, as indicated. The dashed line indicates the zero current level. The pipette solution consisted of 140 mM potassium chloride, 1.2 mM magnesium chloride, 2.6 mM calcium chloride, and 10 mM HEPES (pH 7.4 with potassium hydroxide). The internal solution consisted of 107 mM potassium chloride, 1 mM potassium sulfate, 1 mM calcium chloride, 10 mM EGTA (egtazic acid), 10 mM HEPES (pH 7.2 with potassium hydroxide), and 100 µM ATP, as indicated. Panel E shows the relation between the ATP concentration and the KATP current, expressed relative to the current in the absence of nucleotide, for Kir6.2–SUR1 in six oocytes (open circles), Kir6.2-R201H–SUR1 in six oocytes (solid circles), and a 1:1 mixture of Kir6.2-R201H and Kir6.2 coexpressed with SUR1 in six oocytes (diamonds). The lines are the best fit of the Hill equation to the mean data: for Kir6.2–SUR1, the concentration at which inhibition is half maximal (IC50) is 6.6 µM, and the Hill coefficient (h) is 1.1; for Kir6.2-R201H–SUR1, IC50 is 245 µM and h is 2. For the 1:1 mixture, the line is the best fit to the following equation: a(1 ÷ [1 + ([ATP] ÷ 245 µM)2]) + (1 – a)(1 ÷ [1 +( [ATP] ÷ IC50)h]), where [ATP] is the ATP concentration, IC50 is 7.6 µM, h is 1.6, and a (the fraction of the homomeric R201H channels) is 0.04.

 
To explore the mechanisms underlying these findings, we examined the nucleotide sensitivity of wild-type and mutant channels in inside-out patches (Figure 5D). Kir6.2-R201H–SUR1 channels were considerably less sensitive than wild-type channels to intracellular ATP; mutant channels were half maximally blocked at an ATP concentration of 262±33 µM, as compared with an ATP concentration of 7±1 µM for Kir6.2–SUR1 channels (P<0.001) (Figure 5E). However, mutant channels were activated by Mg-ADP to a similar extent. The single-channel conductance and the fraction of time the channel spends in the open state (the "open probability") were normal.

To simulate the effect of heterozygosity, we injected oocytes with SUR1 and a 1:1 mixture of Kir6.2 and Kir6.2-R201H mRNA. The resting current of oocytes injected with the 1:1 mixture was slightly, but not significantly, greater (0.27±0.07 nA) than that of oocytes with the wild-type channel (0.13±0.05 nA) (P=0.12) (Figure 5C). The KATP currents of mutant channels were further activated by azide and blocked by tolbutamide, to an extent similar to that in the wild-type channel. The ATP sensitivity was also close to that of the wild-type channel, with an IC50 value of 7.6±0.4 µM (Figure 5E). However, the KATP currents of mutant channels were significantly larger than those of wild-type channels at ATP concentrations of 1 µM (P=0.002) and 3 µM (P=0.008), due to the difference in the Hill coefficient.

Discussion

Our findings show that heterozygous activating mutations in the gene encoding the Kir6.2 subunit of the KATP channel can cause both familial and sporadic neonatal diabetes. This genetic subtype may be a relatively common cause of permanent neonatal diabetes, since we found it in 34 percent of probands. Some patients with mutations in the gene encoding Kir6.2 have marked developmental delay, muscle weakness, and epilepsy, in addition to neonatal diabetes. These observations point to the critical role of KATP channels in pancreatic beta cells and suggest a role in human muscle and brain.

The evidence that these mutations are causal is very strong. They cosegregated with diabetes in the two families with vertical transmission, and the nonfamilial cases of diabetes were associated with spontaneous mutations (since the mutation was not present in the normoglycemic parents). Approximately 1 in 106 people is likely to have a spontaneous mutation in a gene of this size, so nine such mutations is highly unlikely to be a chance observation. The most common mutation (resulting in the R201H substitution) occurs within a CpG dinucleotide, a "hot spot" for mutations in mammalian genes. This probably explains the recurrent finding of the R201H mutation in unrelated families from different countries. Since the majority of the mutations are spontaneous, a family history of diabetes is frequently not present.

Diabetes was diagnosed at a mean age of seven weeks and within the first three months of life in 10 of the 13 patients. Although three patients presented with ketoacidosis, it is likely that at least some patients had minimal secretion of endogenous insulin, since in most patients the disease was not diagnosed immediately after birth, and some had detectable C-peptide concentrations. Patients with Kir6.2 mutations may show some overlap with type 1 diabetes in terms of clinical features, but none of our patients had beta-cell autoantibodies. The extent to which mutations in the gene encoding Kir6.2 account for antibody-negative type 1 diabetes requires investigation.

The severe intrauterine growth retardation found in the patients with Kir6.2 mutations is consistent with greatly reduced or absent insulin secretion in utero and is also seen in patients with glucokinase deficiency, loss of an imprinted region of chromosome 6q24 (which results in transient neonatal diabetes), and pancreatic agenesis.2,3,7,23 Marked postnatal catch-up growth is a feature of these conditions and was also observed in the patients with Kir6.2 mutations who did not have neurologic abnormalities.

Mutations in the gene encoding Kir6.2 probably cause decreased secretion of insulin from beta cells by conferring reduced sensitivity to ATP, which is predicted to result in gain of channel function. Functional analysis of the most common mutation, R201H, showed that the homozygous mutation led to markedly reduced sensitivity to ATP. When wild-type and mutant subunits were coexpressed to simulate the heterozygous state, the ATP sensitivity of the resulting mixed population of heteromeric channels was similar to that of the wild type, except at low ATP concentrations. However, we expect that there will be a small population of homomeric R210H channels with lower ATP sensitivity (about 6 percent of the channels if the number of mutant subunits in the tetrameric channel is binomially distributed). Indeed, such ATP-insensitive channels were observed at the single-channel level (data not shown). Although this current is difficult to measure at high ATP concentrations, it may be sufficient to keep the beta cell hyperpolarized even in the presence of glucose, thereby reducing electrical activity and insulin release. Our results indicate that very small changes in the resting KATP current, due to small changes in ATP sensitivity, can impair insulin secretion sufficiently to cause diabetes in humans. This finding is consistent with some24 but not all25 in vitro studies that suggest that a Kir6.2 polymorphism in which lysine replaces glutamic acid at position 23 (E23K) shows small changes in ATP sensitivity.

A molecular model of the C terminal of Kir6.226 predicts that R201 lies close to the phosphate tail of ATP and that it interacts with the alpha phosphate of ATP. The concept of a critical role for residue 201 in ATP binding is supported by the finding that the ATP sensitivity of KATP channels is reduced when the arginine at position 201 is mutated to histidine and other residues.27,28 Three mutations (Q52R, V59M, and V59G) are found in the slide helix; residue 52 lies at one end of the helix, and residue 59 lies midway along its length (Figure 3). The position of the slide helix implies a role in the regulation of channel gating,21 but it lies distant from the predicted ATP-binding site. Additional work is required to elucidate the mechanism by which the mutations that lie in the slide-helix domain effect disease.

Identification of mutations in the gene encoding the KATP-channel subunit Kir6.2 may have important implications for the treatment of affected patients. Our functional studies in vitro suggest that if the KATP channel could be closed by an ATP-independent mechanism (e.g., by sulfonylureas), insulin secretion might be restored. Patients with mutations affecting position 201 did have clear, but subnormal, insulin responses to intravenous tolbutamide. This observation suggests that the pathophysiological condition in humans mirrors the findings in vitro, raising the possibility of novel treatment strategies based on sulfonylureas (or other specific KATP-channel inhibitors) in these apparently insulin-dependent patients. Of note, one patient with an R201H mutation (the proband's father in family BR 1), who had always been treated with tolbutamide, had C-peptide levels in the normal range and good glycemic control. Further investigation is needed to determine whether the identification of a mutation in the gene encoding Kir6.2 will permit treatment to be given in the form of oral agents rather than subcutaneously injected insulin.

It is unlikely that the severe developmental delay, muscle weakness, and epilepsy seen in a subgroup of the patients with Kir6.2 mutations result from diabetes or its treatment. Severe developmental delay and persistent epilepsy are rare in children with neonatal diabetes2,3,6,7; moreover, in our study, neurologic diagnosis preceded clinically recognized episodes of hypoglycemia, and the contractures seen at birth in two of the patients suggest that neurologic dysfunction was present in utero. Kir6.2 is the pore-forming subunit of KATP channels in skeletal muscle and neurons throughout the brain29,30; hence, altered activity of these channels could cause developmental delay, muscle weakness, and epilepsy. Studies in animal models to assess skeletal muscle and the neurologic effects of gain-of-function mutations have not been performed; however, loss of function of the KATP channel can result in hypoxia-induced seizures,31 and overexpression of SUR1 in forebrain reduces the susceptibility to seizures.32 Analysis of additional patients will be necessary to determine whether Kir6.2 mutations give rise to a discrete syndrome characterized by developmental delay, epilepsy, and neonatal diabetes.

The position and type of the mutation may influence the phenotype. All eight patients with mutations at residue 201 had diabetes but no neurologic abnormalities. The V59M variant is associated both with isolated diabetes and with marked developmental delay in addition to diabetes. This kind of genetic behavior — one in which the same mutation is associated with different phenotypes in different families — has been observed with other genes, such as LMNA.33

That heterozygous mutations of Kir6.2 cause diabetes confirms that the KATP-channel–dependent pathway is critical for insulin secretion and that other, KATP-channel–independent pathways are unable to compensate for its loss. Mutations with a less severe functional effect or modification by the genetic background might lead to transient neonatal diabetes or to diabetes that becomes manifest after the neonatal period. Indeed, we and others have shown that the common Kir6.2 polymorphism E23K is associated with a slightly increased susceptibility to type 2 diabetes.24,34,35

In conclusion, activating mutations in the gene encoding the ATP-sensitive potassium-channel subunit Kir6.2 cause neonatal diabetes, and in some patients, neurologic abnormalities. The preliminary finding that tolbutamide partly compensates for the effect of the most common mutation on insulin secretion offers hope that in at least some cases the diabetes may be effectively treated with sulfonylurea tablets.

Supported in part by funds from the Wellcome Trust and Diabetes UK (to the Institute of Biomedical and Clinical Science, Peninsula Medical School, Exeter); by grants from the Royal Society, the Wellcome Trust, and the Medical Research Council (to the Laboratory of Physiology, Oxford University, Oxford); by a grant from the Dutch Growth Foundation (to Dr. Slingerland); and by grants from the University of Bergen and Haukeland University Hospital (to the Institute for Clinical Medicine and Molecular Medicine, University of Bergen, Bergen). Dr. Hattersley is a Wellcome Trust Clinical Research Leave Fellow, Dr. Pearson is a Wellcome Trust Clinical Research Fellow, and Dr. Ashcroft is the Royal Society GlaxoSmithKline Research Professor.

We are indebted to the International Society for Pediatric and Adolescent Diabetes, which set up the ISPAD Rare Diabetes registry; to the Child Health and Well-Being Fund, Rotterdam, the Netherlands, which funded its establishment; to Peter Turnpenny and Julia Rankin for their advice; and to the Royal Devon and Exeter National Health Service Health Care Trust for their continued support.

* Dr. Pearson, Ms. Antcliff, and Dr. Proks contributed equally to the article.


Source Information

From the Institute of Biomedical and Clinical Science, Peninsula Medical School, Exeter, United Kingdom (A.L.G., E.R.P., E.L.E., T.M.F., S.E., A.T.H.); the University Laboratory of Physiology, Oxford University, Oxford, United Kingdom (J.F.A., P.P., F.M.A.); Sophia Children's Hospital, Rotterdam, the Netherlands, (G.J.B., A.S.S.); the Institute of Endocrinology and Diabetes, Children's Hospital at Westmead, Westmead, Australia (N.H., S.S.); Piaui State University Medical School, Teresina, Piaui, Brazil (J.M.C.L.S.); the Institute for Clinical Medicine and Molecular Medicine, University of Bergen, Bergen, Norway (J.M., P.R.N.); Wessex Clinical Genetics Service and the Division of Human Genetics, Southampton University and Hospitals, National Health Service Trust, Southampton, United Kingdom (I.K.T.); Wessex Regional Genetics Laboratories, Salisbury District Hospital, Salisbury, United Kingdom (D.M.); Royal Hospital for Children, Bristol, United Kingdom (J.P.H.S.); Second Department of Pediatrics and Second Faculty of Medicine, Charles University, Prague, Czech Republic (Z.S.); Meander Medical Center, Amersfoort, the Netherlands (A.R.); Academic Unit of Child Health, Sheffield Children's Hospital, Sheffield, United Kingdom (J.K.H.W.); Regional Endocrine Laboratory, Birmingham, United Kingdom (P.C.); St. Luke's Hospital, Bradford, United Kingdom (S.G.); and the Division of Pediatric Endocrinology and Diabetes, Hackensack University Medical Center, Hackensack, N.J. (J.A.).

Address reprint requests to Dr. Hattersley at Diabetes and Vascular Medicine, Institute of Biomedical and Clinical Science, Peninsula Medical School, Barrack Rd., Exeter EX2 5AX, United Kingdom, or at a.t.hattersley{at}ex.ac.uk.

References

  1. Shield JP. Neonatal diabetes: new insights into aetiology and implications. Horm Res 2000;53:Suppl 1:7-11. [Web of Science][Medline]
  2. Temple IK, Gardner RJ, Mackay DJ, Barber JC, Robinson DO, Shield JP. Transient neonatal diabetes: widening the understanding of the etiopathogenesis of diabetes. Diabetes 2000;49:1359-1366. [Abstract]
  3. Njølstad PR, Søvik O, Cuesta-Muñoz A, et al. Neonatal diabetes mellitus due to complete glucokinase deficiency. N Engl J Med 2001;344:1588-1592. [Free Full Text]
  4. Gloyn AL, Ellard S, Shield JP, et al. Complete glucokinase deficiency is not a common cause of permanent neonatal diabetes. Diabetologia 2002;45:290-290. [CrossRef][Web of Science][Medline]
  5. Vaxillaire M, Samson C, Cave H, Metz C, Froguel P, Polak M. Glucokinase gene mutations are not a common cause of permanent neonatal diabetes in France. Diabetologia 2002;45:454-455. [CrossRef][Web of Science][Medline]
  6. Njølstad PR, Sagen JV, Bjorkhaug L, et al. Permanent neonatal diabetes caused by glucokinase deficiency: inborn error of glucose-insulin signaling pathway. Diabetes 2003;52:2854-2860. [Free Full Text]
  7. Stoffers DA, Zinkin NT, Stanojevic V, Clarke WL, Habener JF. Pancreatic agenesis attributable to a single nucleotide deletion in the human IPF1 gene coding sequence. Nat Genet 1997;15:106-110. [CrossRef][Web of Science][Medline]
  8. Delepine M, Nicolino M, Barrett T, Golamaully M, Lathrop GM, Julier C. EIF2AK3, encoding translation initiation factor 2-alpha kinase 3, is mutated in patients with Wolcott-Rallison syndrome. Nat Genet 2000;25:406-409. [CrossRef][Web of Science][Medline]
  9. Wildin RS, Ramsdell F, Peake J, et al. X-linked neonatal diabetes mellitus, enteropathy and endocrinopathy syndrome is the human equivalent of mouse scurfy. Nat Genet 2001;27:18-20. [CrossRef][Web of Science][Medline]
  10. Gribble FM, Reimann F. Sulphonylurea action revisited: the post-cloning era. Diabetologia 2003;46:875-891. [CrossRef][Web of Science][Medline]
  11. Clement JP IV, Kunjilwar K, Gonzalez G, et al. Association and stoichiometry of K(ATP) channel subunits. Neuron 1997;18:827-838. [CrossRef][Web of Science][Medline]
  12. Thomas PM, Ye Y, Lightner E. Mutation of the pancreatic islet inward rectifier, Kir6.2 also leads to familial persistent hyperinsulinemic hypoglycemia of infancy. Hum Mol Genet 1996;5:1809-1812. [Free Full Text]
  13. Glaser B, Kesavan P, Heyman M, et al. Familial hyperinsulinism caused by an activating glucokinase mutation. N Engl J Med 1998;338:226-230. [Free Full Text]
  14. Nichols CG, Koster JC. Diabetes and insulin secretion: whither KATP? Am J Physiol Endocrinol Metab 2002;283:E403-E412. [Free Full Text]
  15. Koster JC, Marshall BA, Ensor N, Corbett JA, Nichols CG. Targeted overactivity of beta cell K(ATP) channels induces profound neonatal diabetes. Cell 2000;100:645-654. [CrossRef][Web of Science][Medline]
  16. Frayling TM, Lindgren CM, Chevre JC, et al. A genome-wide scan in families with maturity-onset diabetes of the young: evidence for further genetic heterogeneity. Diabetes 2003;52:872-881. [Free Full Text]
  17. Inoue H, Ferrer J, Warren-Perry M, et al. Sequence variants in the pancreatic islet beta-cell inwardly rectifying K+ channel Kir6.2 (Bir) gene: identification and lack of role in Caucasian patients with NIDDM. Diabetes 1997;46:502-507. [Abstract]
  18. Pearson ER, Starkey BJ, Powell RJ, Gribble FM, Clark PM, Hattersley AT. Genetic cause of hyperglycaemia determines response to treatment in diabetes. Lancet 2003;362:1275-1281. [CrossRef][Web of Science][Medline]
  19. Gribble FM, Ashfield R, Ämmälä C, Ashcroft FM. Properties of cloned ATP-sensitive K+ currents expressed in Xenopus oocytes. J Physiol 1997;498:87-98. [Free Full Text]
  20. Trapp S, Proks P, Tucker SJ, Ashcroft FM. Molecular analysis of ATP-sensitive K channel gating and implications for channel inhibition by ATP. J Gen Physiol 1998;112:333-349. [Free Full Text]
  21. Kuo A, Gulbis JM, Antcliff JF, et al. Crystal structure of the potassium channel KirBac1.1 in the closed state. Science 2003;300:1922-1926. [Free Full Text]
  22. Freeman JV, Cole TJ, Chinn S, Jones PR, White EM, Preece MA. Cross sectional stature and weight reference curves for the UK, 1990. Arch Dis Child 1995;73:17-24. [Free Full Text]
  23. Hattersley AT, Beards F, Ballantyne E, Appleton M, Harvey R, Ellard S. Mutations in the glucokinase gene of the fetus result in reduced birth weight. Nat Genet 1998;19:268-270. [CrossRef][Web of Science][Medline]
  24. Schwanstecher C, Meyer U, Schwanstecher M. K(IR)6.2 polymorphism predisposes to type 2 diabetes by inducing overactivity of pancreatic beta-cell ATP-sensitive K(+) channels. Diabetes 2002;51:875-879. [Free Full Text]
  25. Riedel MJ, Boora P, Steckley D, de Vries G, Light PE. Kir6.2 polymorphisms sensitize beta-cell ATP-sensitive potassium channels to activation by acyl CoAs: a possible cellular mechanism for increased susceptibility to type 2 diabetes? Diabetes 2003;52:2630-2635. [Free Full Text]
  26. Trapp S, Haider S, Jones P, Sansom MS, Ashcroft FM. Identification of residues contributing to the ATP binding site of Kir6.2. EMBO J 2003;22:2903-2912. [CrossRef][Web of Science][Medline]
  27. Ribalet B, John SA, Weiss JN. Molecular basis for Kir6.2 channel inhibition by adenine nucleotides. Biophys J 2003;84:266-276. [Medline]
  28. Shyng SL, Cukras CA, Harwood J, Nichols CG. Structural determinants of PIP(2) regulation of inward rectifier K(ATP) channels. J Gen Physiol 2000;116:599-608. [Free Full Text]
  29. Karschin C, Ecke C, Ashcroft FM, Karschin A. Overlapping distribution of K(ATP) channel-forming Kir6.2 subunit and the sulfonylurea receptor SUR1 in rodent brain. FEBS Lett 1997;401:59-64. [CrossRef][Web of Science][Medline]
  30. Inagaki N, Gonoi T, Clement JP IV, et al. Reconstitution of IKATP: an inward rectifier subunit plus the sulfonylurea receptor. Science 1995;270:1166-1170. [Free Full Text]
  31. Yamada K, Ji JJ, Yuan H, et al. Protective role of ATP-sensitive potassium channels in hypoxia-induced generalized seizure. Science 2001;292:1543-1546. [Free Full Text]
  32. Hernandez-Sanchez C, Basile AS, Fedorova I, et al. Mice transgenically overexpressing sulfonylurea receptor 1 in forebrain resist seizure induction and excitotoxic neuron death. Proc Natl Acad Sci U S A 2001;98:3549-3554. [Free Full Text]
  33. Novelli G, D'Apice MR. The strange case of the "lumper" lamin A/C gene and human premature ageing. Trends Mol Med 2003;9:370-375. [CrossRef][Web of Science][Medline]
  34. Gloyn AL, Weedon MN, Owen KR, et al. Large-scale association studies of variants in genes encoding the pancreatic beta-cell KATP channel subunits Kir6.2 (KCNJ11) and SUR1 (ABCC8) confirm that the KCNJ11 E23K variant is associated with type 2 diabetes. Diabetes 2003;52:568-572. [Free Full Text]
  35. Nielsen EM, Hansen L, Carstensen B, et al. The E23K variant of Kir6.2 associates with impaired post-OGTT serum insulin response and increased risk of type 2 diabetes. Diabetes 2003;52:573-577. [Free Full Text]

 

This Article
-Abstract
- PDF
-PDA Full Text
-PowerPoint Slide Set
-Supplementary Material

Commentary
-Perspective
 by Gribble, F. M.

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited
-E-mail When Letters Appear

More Information
-Related Article
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.