Myostatin Mutation Associated with Gross Muscle Hypertrophy in a Child
Markus Schuelke, M.D., Kathryn R. Wagner, M.D., Ph.D., Leslie E. Stolz, Ph.D., Christoph Hübner, M.D., Thomas Riebel, M.D., Wolfgang Kömen, M.D., Thomas Braun, M.D., Ph.D., James F. Tobin, Ph.D., and Se-Jin Lee, M.D., Ph.D.
Muscle wasting and weakness are among the most common inheritedand acquired disorders and include the muscular dystrophies,cachexia, and age-related wasting. Since there is no generallyaccepted treatment to improve muscle bulk and strength, theseconditions pose a substantial burden to patients as well asto public health. Consequently, there has been considerableinterest in a recently described inhibitor of muscle growth,myostatin, or growth/differentiation factor 8 (GDF-8), whichbelongs to the transforming growth factor superfamily of secretedproteins that control the growth and differentiation of tissuesthroughout the body. The myostatin gene is expressed almostexclusively in cells of skeletal-muscle lineage throughout embryonicdevelopment as well as in adult animals and functions as a negativeregulator of muscle growth.1,2 Targeted disruption of the myostatingene in mice doubles skeletal-muscle mass.1 Conversely, systemicoverexpression of the myostatin gene leads to a wasting syndromecharacterized by extensive muscle loss.3 In adult animals, myostatinappears to inhibit the activation of satellite cells, whichare stem cells resident in skeletal muscle.4,5
The potential relevance of myostatin to the treatment of diseasein humans has been suggested by studies involving mdx mice,which carry a mutation in the dystrophin gene and thereforeserve as a genetic model of Duchenne's and Becker's musculardystrophy.6 For example, mdx mice that lacked myostatin werefound not only to be stronger and more muscular than their mdxcounterparts with normal myostatin, but also to have reducedfibrosis and fatty remodeling, suggesting improved regenerationof muscle.7 Furthermore, injection of neutralizing monoclonalantibodies directed against myostatin into either wild-typeor mdx mice increases muscle mass and specific force, suggestingthat myostatin plays an important role in regulating musclegrowth in adult animals.8,9
The function of myostatin appears to be conserved across species,since mutations in the myostatin gene have been shown to beresponsible for the "double-muscling" phenotype in cattle.10,11,12,13The phenotypes of mice and cattle lacking myostatin and thehigh degree of sequence conservation of the predicted myostatinprotein in many mammalian species have raised the possibilitythat myostatin may help regulate muscle growth in humans. Wereport the identification of a myostatin mutation in a childwith muscle hypertrophy, thereby providing strong evidence thatmyostatin does play an important role in regulating muscle massin humans.
Case Report
A healthy woman who was a former professional athlete gave birthto a son after a normal pregnancy. The identity of the child'sfather was not revealed. The child's birth weight was in the75th percentile. Stimulus-induced myoclonus developed severalhours after birth, and the infant was admitted to the neonatalward for assessment. He appeared extraordinarily muscular, withprotruding muscles in his thighs (Figure 1A) and upper arms.With the exception of increased tendon reflexes, the physicalexamination was normal. Hypoglycemia and increased levels oftestosterone and insulin-like growth factor I were excluded.Muscular hypertrophy was verified by ultrasonography when theinfant was six days of age (Figure 1B and Figure 1C). Dopplerechocardiography and electrocardiography performed soon afterbirth and every six months thereafter were consistently normal.At 4.3 years of age (body-surface area, 0.78 m2), the childhad a pulse rate of 95 beats per minute, a left ventricularejection fraction of 70 percent, fractional shortening at themidwall of 56 percent, and a cardiac output of 2.81 liters perminute, with a left ventricular measurement of 3.42 cm duringdiastole (50th percentile) and 1.99 cm (25th percentile) duringsystole and respective septal measurements of 0.59 cm (75thpercentile) and 0.81 cm (75th percentile).
Figure 1. Photographs of the Child at the Ages of Six Days and Seven Months (Panel A), Ultrasonograms (Panel B) and Morphometric Analysis (Panel C) of the Muscles of the Patient and a Control Infant, and the Patient's Pedigree (Panel D).
The arrowheads in Panel A indicate the protruding muscles of the patient's thigh and calf. In Panel B, an ultrasonographic transverse section (linear transducer, 10 MHz) through the middle portion of the thigh reveals differences between the patient and a control infant of the same age, sex, and weight. VL denotes vastus lateralis, VI vastus intermedius, VM vastus medialis, RF rectus femoris, and F femur. In Panel C, retracings of the muscle outlines and results of the morphometric analysis of the muscle cross-sectional planes of the two infants also reveal marked differences. Panel D shows the patient's pedigree. Solid symbols denote family members who are exceptionally strong, according to information in their clinical history. Square symbols denote male family members, and circles female family members.
The stimulus-induced myoclonus gradually subsided after twomonths. The child's motor and mental development has been normal.Now, at 4.5 years of age, he continues to have increased musclebulk and strength, and he is able to hold two 3-kg dumbbellsin horizontal suspension with his arms extended.
Several family members (Figure 1D) have been reported to beunusually strong. Family member II-3 was a construction workerwho was able to unload curbstones by hand. The 24-year-old motherof the child (III-5) appeared muscular, though not to the extentobserved in her son; she did not report any health problems.No family members aside from the mother were available to providesamples for genetic analysis.
Methods
The study was approved by the institutional ethics review committeeof the Charité, University Medical Center Berlin. Writteninformed consent was obtained from the child's mother as wellas from the parents of all control subjects. Investigationswere conducted in accordance with the Declaration of Helsinki(2000).
All three exons of myostatin and flanking intron sequences (GenBankNT_022197) were amplified from genomic DNA by means of the polymerasechain reaction (PCR) with the following oligonucleotides: exon1 forward primer, 5'ATTCACTGGTGTGGCAAGTTG3'; exon 1 reverseprimer, 5'CAGCAGAACTGTTGATATACACTAATAGG3'; exon 2 forward primer,5'GTTAATGGGAAATAATTTCAGCAAC3'; exon 2 reverse primer, 5'AGGTTATTATAATGTTATTTTCAGTTATCAC3';exon 3 forward primer, 5'CAGGCCTATTGATATTACTGATTGTTC3'; andexon 3 reverse primer, 5'GACTGTAGCATACTCTAGGCCTATAGCC3'. Thesamples were then subjected to bidirectional automatic sequencing(BigDye Terminator, Applied Biosystems), and the presence ofthe g.IVS1+5 ga mutation was verified by a primer-induced restrictionassay with the forward primer 5'CAAAGCTCCTCCACTCCGG3' and thereverse-mismatch primer (mismatch underlined) 5'CAGCAGAACTGTTCATATACACTAATAGGTCTA3'.Total RNA was extracted from EpsteinBarr virus (EBV)immortalized lymphoblastoid cells with TRIzol and reverse-transcribedwith Superscript III (Invitrogen). Several primer combinationsacross the boundary between exon 1 and exon 2 were used: 5'CATGCAAAAACTGCAACTCTGTGT3'(P1F), 5'AAATGAGAACAGTGAGCAA3' (P2F), 5'CAAAGCTCCTCCACTCCGG3'(P3R), and 5'ATCCATAGTTGGGCCTTTACTACTTTA3' (P4R). As the reverse-transcribedcontrol, HPRT was coamplified in a multiplex PCR (primers, 5'CCTGCTGGATTACATTAAAGCACTG3'and 5'CCTGAAGTATTCATTATAGTCAAGG3').
An 8.4-kb DNA fragment spanning the entire human myostatin genefrom the 5' end of the messenger RNA (mRNA) to a site 1.4 kbdownstream of the polyadenylation signal was cloned into pCMV5and MDAF2 vectors, and the mutation was introduced by site-directedmutagenesis. COS-7, Chinese-hamsterovary, and A204 rhabdomyosarcomacells were transiently transfected with wild-type or mutantplasmids. Cells were cotransfected with plasmid containing asecreted myc-tagged protein as a transfection-efficiency controland with an expression construct for the furin protease paireddibasic amino acidcleaving enzyme to improve processingof the precursor myostatin protein.14 Conditioned medium wasconcentrated, separated by reducing sodium dodecyl sulfatepolyacrylamide-gelelectrophoresis, and transferred onto a membrane. Myostatinwas detected with the use of polyclonal antibodies against aC-terminal domain.1 The control myc-tagged protein was detectedwith the use of a monoclonal antibody against myc.
RNA from transiently transfected cells was treated with DNaseI (Invitrogen) and amplified by means of reverse-transcriptasePCR with P2F and P4R primers. Wild-type and mutant bands wereexcised from the agarose gel, purified, and sequenced. The relativeabundance of the wild-type and mutant bands was determined bymeasuring the relative fluorescence after amplification witha FAM-labeled P4R primer on an ABI 3100 gene scanner (AppliedBiosystems).
For immunoprecipitation and Western blotting, JA-16coupledbeads (directed against a C-terminal peptide of myostatin) wereprepared and myostatin was immunoprecipitated by incubating60 µl of packed beads with 0.5 ml of serum.15 After washing,bound myostatin was eluted and further separated by sodium dodecylsulfatepolyacrylamide-gel electrophoresis, blotted ona membrane, and probed with the polyclonal rabbit antibody L8825against myostatin propeptide.
Results
Imaging
Ultrasonography showed that the cross-sectional plane of thepatient's quadriceps muscle was 7.2 SD above the mean (±SD)value for 10 age- and sex-matched controls (6.72 cm2 vs. 3.13±0.49cm2). Moreover, the thickness of his subcutaneous fat pad was2.88 SD below the mean value for controls (0.18 cm vs. 0.36±0.06cm). There was no significant difference in the diameter ofthe femoral bone between the patient and the controls (0.57cm vs. 0.50±0.13 cm). The echogenicity of the musclewas normal, with no indication of fibrosis or deposition offat tissue (Figure 1B and Figure 1C).
Molecular Biology
The phenotype of our patient was reminiscent of the increasedmuscling and decreased adiposity reported in mice1,16,17,18and cattle10,11,12,13 with loss-of-function mutations in themyostatin gene. Therefore, we sequenced all exons and flankingintron regions of the gene in the patient and his mother. Althoughno mutations were detected in the coding region, a ga transitionat nucleotide g.IVS1+5 was present in both alleles of the patientand one allele of his mother. The mutation was confirmed byrestriction analysis (Figure 2A) and was absent in 200 allelesfrom control subjects with a similar ethnic background, thusexcluding a common polymorphism.
Panel A shows the results of primer-induced restriction analysis for the presence of the g.IVS1+5 ga mutation in the patient, his mother, and a control subject. AccI cleaves a fragment of 166 bp into two segments one of 135 bp and one of 31 bp only if the wild-type sequence is present. Lanes 3 and 4 show cleaved (cut) and uncleaved (uncut) segments from a control subject. Panel B shows the results of multiplex reverse-transcriptase PCR of messenger RNA (mRNA) from the patient and two control subjects in EpsteinBarr virusimmortalized lymphoblastoid cells. A housekeeping gene (HPRT) was amplified along with various fragments of the myostatin gene and yielded a product of equal intensity in all reactions. No myostatin product could be amplified from RNA from the patient, indicating nonsense-mediated messenger decay. Panel C shows the products of reverse-transcriptase PCR generated with the use of P2F and P4R primers from wild-type myostatin constructs (lanes 1 and 2) and mutant myostatin constructs (lanes 3 and 4) transfected into COS-7 cells, with (lanes 1 and 3) and without (lanes 2 and 4) reverse transcriptase. In the presence of the mutation, 68 percent of the precursor mRNA is spliced incorrectly. Panel D shows that mutant myostatin has a g.IVS1+5 ga transition at the splice donor site in intron 1, causing splicing to occur 108 bp downstream at a cryptic splice site, which produces a larger transcript in the mutant and results in a premature termination codon. CMV denotes promoter sequences derived from cytomegalovirus.
The presence of this mutation raised the possibility of missplicingof the myostatin precursor mRNA in the patient, since the +5position at the splice donor site is a common location for splice-sitemutations in humans.19 When we applied the scoring method ofShapiro and Senapathy20 to analyze the degree of matching betweenthe sequence of the splice donor site of intron 1 with the correspondingconsensus sequence (AG//gtrag), the score dropped from 79.4(wild type, GT//gtaagt) to 65.0 (mutant, GT//gtaaat), indicatingthat missplicing is likely.
In order to investigate the effect of this mutation on the maturationof the myostatin mRNA, we generated genomic wild-type and mutantconstructs for the expression of human myostatin mRNA in culturedmuscle and nonmuscle cells and performed reverse-transcriptasePCR on RNA isolated from the transfected cells. PCR across theboundary between exon 1 and exon 2 yielded a single band of405 bp for the wild-type construct. For the mutant construct,however, we detected two PCR products, a faint band equivalentin size to that obtained after transfection of the wild-typeconstruct and a major novel product of higher molecular weight(Figure 2C). This product contained an insertion of the first108 bp of intron 1 (including the g.IVS1+5 ga mutation) andresulted from the activation of a cryptic splice site withinintron 1 (at//gtaagt) (Figure 2D). Quantification of the relativeintensities of the major and minor bands obtained from thesePCR reactions showed that 68.8±0.032 percent (three samples)of the myostatin mRNA from the mutant construct was misspliced(Figure 2C). The misspliced mRNA is predicted to give rise toa severely truncated protein, since the 108-bp insertion addsa single lysine residue followed by a premature terminationcodon.
Consistent with the results of RNA analysis, myostatin proteinwas detected only in the conditioned medium from COS-7 cellstransfected with the wild-type construct, whereas it was virtuallyabsent in cells transfected with the mutant construct (Figure 3A).Similar results were obtained with other cell lines, includingChinese-hamsterovary cells and A204 rhabdomyosarcomacells (data not shown).
Figure 3. Results of Western Blotting and Immunoprecipitation.
Panel A shows the lack of myostatin production from mutant genomic myostatin constructs in conditioned medium from transiently transfected COS-7 cells. Antibodies against the mature C-terminal domain of myostatin recognize a 12-kD band from wild-type constructs (lane 1) but not mutant constructs (lane 2). As a control, cells were cotransfected with a myc-tagged protein, which was abundantly expressed in both populations. Panel B shows the results of immunoprecipitation or mock immunoprecipitation (IP) and Western blotting of serum samples from rats (lanes 1, 2, and 3), control subjects (lanes 4, 5, and 6), and the patient (lane 7) with (lanes 1, 2, 4, 5, 7, and 8) or without (lanes 3 and 6) JA-16 antibodies against the myostatin C-terminal domain as an immunoprecipitant. The Western blot was then probed with antibodies against the myostatin propeptide. A band corresponding to myostatin propeptide was present in high levels in rat serum and to a lesser degree in serum from control subjects and was absent in serum from the patient.
We also sought to confirm the effect of this splice-site mutationin samples from the patient. Because we lacked a muscle-biopsyspecimen, we examined myostatin mRNA from the patient's EBV-immortalizedlymphoblastoid cells. These cells tend to express low levelsof illegitimate transcripts, not normally present in blood cells.Illegitimate transcription proceeds through the normal promotersand may be used for the detection of mutations on the mRNA levelif specific tissue is unavailable.21 We did not find any myostatinproducts in cells from the patient (Figure 2B). We believe thatgeneral degradation of mRNA is an unlikely explanation for thisnegative result, since we were able to detect similar levelsof transcripts of a housekeeping gene (HPRT) in the patientand controls. Mutant transcripts may be specifically degradedthrough nonsense-mediated messenger decay, since the prematuretermination codon is located upstream of a spliceable exon.22
Finally, we attempted to measure myostatin levels in the patient'sserum samples. Myostatin is readily detected by Western blottingin serum samples from mice.3 Similar approaches have provedmuch more difficult in human serum samples, presumably becausehumans have lower circulating myostatin levels. Using an antibodyagainst myostatin, we first concentrated myostatin in serumsamples by immunoprecipitation and then detected its presencewith a second antibody against the propeptide region. We optedfor the antibody directed against the propeptide (L8825), sinceit binds more tightly and picks up smaller amounts of proteinthan the antibody against mature myostatin. We identified aband at approximately 36 kD in rat serum, corresponding to myostatinpropeptide. It was present to a lesser degree in the serum samplesfrom age- and sex-matched control subjects but was absent inthe patient's serum (Figure 3B). Since the molar ratio betweenpropeptide and mature myostatin in serum is approximately 1:1,15we conclude that the absence of the propeptide indicates theabsence of mature myostatin in the patient.
Discussion
These results strongly indicate that our patient has a loss-of-functionmutation in the myostatin gene, thus suggesting that the inactivationof myostatin has similar effects in humans, mice, and cattle.So far, we have not observed any health problems in the patient.Since myostatin is also expressed in the heart,23 we have closelymonitored our patient's cardiac function but have not yet detectedany signs of cardiomyopathy or a conduction disturbance. However,at 4.5 years of age, our patient is still too young for suchabnormalities to be ruled out definitively. Our results suggestthe possibility that muscle bulk and strength could be therapeuticallyincreased by the inactivation of myostatin in patients withmuscle-wasting conditions.
Supported by funds from the parents' self-help group Helft demMuskelkranken Kind, Hamburg e.V. (to Drs. Schuelke and Hübner),and by grants from the National Institutes of Health (R01HD35887and R01CA88866, to Dr. Lee, and K08NS02212, to Dr. Wagner) andthe Muscular Dystrophy Association (to Dr. Wagner). Dr. Hübneris a member of the Network on Muscular Dystrophies (01GM0302),which is funded by the German Ministry of Education and Research,Bonn, Germany.
Drs. Stolz and Tobin are employees of Wyeth Pharmaceuticals.Dr. Tobin reports having equity in Wyeth Pharmaceuticals, andDr. Lee reports having served as a paid consultant to and havingequity in MetaMorphix and is named on multiple patents relatedto myostatin, which were licensed by Johns Hopkins Universityto MetaMorphix and sublicensed to Wyeth, and is entitled toa share of sales royalties.
We are indebted to Xiaoli Chang, Antje Gerlach, Christine Gerstenfeld,Heidemarie Neitzel, Thomas Voit, and Angelika Zwirner for theirhelp; to Orest Hurko, Neil Wolfman, and Seamus McDuff for usefuldiscussions; and to Jeremy Nathans for providing the plasmidcontaining a myc-tagged protein and the monoclonal antibodyagainst the myc epitope.
Source Information
From the Departments of Neuropediatrics (M.S., C.H.), Pediatric Radiology (T.R.), and Neonatology (W.K.), Charité, University Medical Center Berlin, Berlin; the Departments of Neurology (K.R.W.) and Molecular Biology and Genetics (S.-J.L.), Johns Hopkins University School of Medicine, Baltimore; the Department of Cardiovascular and Metabolic Diseases, Wyeth Research, Cambridge, Mass. (L.E.S., J.F.T.); and the Institute of Physiological Chemistry, Martin Luther University, Halle-Wittenberg, Germany (T.B.).
Address reprint requests to Dr. Schuelke at the Department of Neuropediatrics, Charité, University Medical Center Berlin, Augustenburger Platz 1, D-13353 Berlin, Germany, or at markus.schuelke{at}charite.de.
References
McPherron AC, Lawler AM, Lee SJ. Regulation of skeletal muscle mass in mice by a new TGF- superfamily member. Nature 1997;387:83-90. [CrossRef][Medline]
Amthor H, Huang R, McKinnell I, et al. The regulation and action of myostatin as a negative regulator of muscle development during avian embryogenesis. Dev Biol 2002;251:241-257. [CrossRef][Web of Science][Medline]
Zimmers TA, Davies MV, Koniaris LG, et al. Induction of cachexia in mice by systemically administered myostatin. Science 2002;296:1486-1488. [Free Full Text]
McCroskery S, Thomas M, Maxwell L, Sharma M, Kambadur R. Myostatin negatively regulates satellite cell activation and self-renewal. J Cell Biol 2003;162:1135-1147. [Free Full Text]
Mauro A. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol 1961;9:493-5.
Sicinski P, Geng Y, Ryder-Cook AS, Barnard EA, Darlison MG, Barnard PJ. The molecular basis of muscular dystrophy in the mdx mouse: a point mutation. Science 1989;244:1578-1580. [Free Full Text]
Wagner KR, McPherron AC, Winik N, Lee SJ. Loss of myostatin attenuates severity of muscular dystrophy in mdx mice. Ann Neurol 2002;52:832-836. [CrossRef][Web of Science][Medline]
Whittemore LA, Song K, Li X, et al. Inhibition of myostatin in adult mice increases skeletal muscle mass and strength. Biochem Biophys Res Commun 2003;300:965-971. [CrossRef][Web of Science][Medline]
Bogdanovich S, Krag TOB, Barton ER, et al. Functional improvement of dystrophic muscle by myostatin blockade. Nature 2002;420:418-421. [CrossRef][Medline]
Grobet L, Martin LJR, Poncelet D, et al. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat Genet 1997;17:71-74. [CrossRef][Web of Science][Medline]
Grobet L, Poncelet D, Royo LJ, et al. Molecular definition of an allelic series of mutations disrupting the myostatin function and causing double-muscling in cattle. Mamm Genome 1998;9:210-213. [CrossRef][Web of Science][Medline]
Kambadur R, Sharma M, Smith TP, Bass JJ. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res 1997;7:910-916. [Free Full Text]
McPherron AC, Lee SJ. Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci U S A 1997;94:12457-12461. [Free Full Text]
Lee SJ, McPherron AC. Regulation of myostatin activity and muscle growth. Proc Natl Acad Sci U S A 2001;98:9306-9311. [Free Full Text]
Hill JJ, Davies MV, Pearson AA, et al. The myostatin propeptide and the follistatin-related gene are inhibitory binding proteins of myostatin in normal serum. J Biol Chem 2002;277:40735-40741. [Free Full Text]
Szabó G, Dallmann G, Müller G, Patthy L, Soller M, Varga L. A deletion in the myostatin gene causes the compact (Cmpt) hypermuscular mutation in mice. Mamm Genome 1998;9:671-672. [CrossRef][Web of Science][Medline]
Lin J, Arnold HB, Della-Fera MA, Azain MJ, Hartzell DL, Baile CA. Myostatin knockout in mice increases myogenesis and decreases adipogenesis. Biochem Biophys Res Commun 2002;291:701-706. [CrossRef][Web of Science][Medline]
McPherron AC, Lee SJ. Suppression of body fat accumulation in myostatin-deficient mice. J Clin Invest 2002;109:595-601. [CrossRef][Web of Science][Medline]
Krawczak M, Reiss J, Cooper DN. The mutational spectrum of single base-pair substitutions in mRNA splice junctions of human genes: causes and consequences. Hum Genet 1992;90:41-54. [Web of Science][Medline]
Shapiro MB, Senapathy P. RNA splice junctions of different classes of eukaryotes: sequence statistics and functional implications in gene expression. Nucleic Acids Res 1987;15:7155-7174. [Free Full Text]
Chelly J, Gilgenkrantz H, Hugnot JP, et al. Illegitimate transcription: application to the analysis of truncated transcripts of the dystrophin gene in nonmuscle cultured cells from Duchenne and Becker patients. J Clin Invest 1991;88:1161-1166. [Web of Science][Medline]
Hentze MW, Kulozik AE. A perfect message: RNA surveillance and nonsense-mediated decay. Cell 1999;96:307-310. [CrossRef][Web of Science][Medline]
Sharma M, Kambadur R, Matthews KG, et al. Myostatin, a transforming growth factor- superfamily member, is expressed in heart muscle and is upregulated in cardiomyocytes after infarct. J Cell Physiol 1999;180:1-9. [CrossRef][Web of Science][Medline]
Sartori, R., Milan, G., Patron, M., Mammucari, C., Blaauw, B., Abraham, R., Sandri, M.
(2009). Smad2 and 3 transcription factors control muscle mass in adulthood. Am. J. Physiol. Cell Physiol.
296: C1248-C1257
[Abstract][Full Text]
Welle, S. L.
(2009). Myostatin and muscle fiber size. Focus on "Smad2 and 3 transcription factors control muscle mass in adulthood" and "Myostatin reduces Akt/TORC1/p70S6K signaling, inhibiting myoblast differentiation and myotube size". Am. J. Physiol. Cell Physiol.
296: C1245-C1247
[Full Text]
LeBrasseur, N. K., Schelhorn, T. M., Bernardo, B. L., Cosgrove, P. G., Loria, P. M., Brown, T. A.
(2009). Myostatin Inhibition Enhances the Effects of Exercise on Performance and Metabolic Outcomes in Aged Mice. J Gerontol A Biol Sci Med Sci
0: glp068v1-glp068
[Abstract][Full Text]
Wen, T., Peng, B., Pintar, J. E.
(2009). The MOR-1 Opioid Receptor Regulates Glucose Homeostasis by Modulating Insulin Secretion. Mol. Endocrinol.
23: 671-678
[Abstract][Full Text]
Hulmi, J. J., Tannerstedt, J., Selanne, H., Kainulainen, H., Kovanen, V., Mero, A. A.
(2009). Resistance exercise with whey protein ingestion affects mTOR signaling pathway and myostatin in men. J. Appl. Physiol.
106: 1720-1729
[Abstract][Full Text]
Rose, F. F. Jr, Mattis, V. B., Rindt, H., Lorson, C. L.
(2009). Delivery of recombinant follistatin lessens disease severity in a mouse model of spinal muscular atrophy. Hum Mol Genet
18: 997-1005
[Abstract][Full Text]
Welle, S., Burgess, K., Mehta, S.
(2009). Stimulation of skeletal muscle myofibrillar protein synthesis, p70 S6 kinase phosphorylation, and ribosomal protein S6 phosphorylation by inhibition of myostatin in mature mice. Am. J. Physiol. Endocrinol. Metab.
296: E567-E572
[Abstract][Full Text]
Ciarmela, P., Wiater, E., Smith, S. M., Vale, W.
(2009). Presence, Actions, and Regulation of Myostatin in Rat Uterus and Myometrial Cells. Endocrinology
150: 906-914
[Abstract][Full Text]
Souza, T. A., Chen, X., Guo, Y., Sava, P., Zhang, J., Hill, J. J., Yaworsky, P. J., Qiu, Y.
(2008). Proteomic Identification and Functional Validation of Activins and Bone Morphogenetic Protein 11 as Candidate Novel Muscle Mass Regulators. Mol. Endocrinol.
22: 2689-2702
[Abstract][Full Text]
Rodgers, B. D., Garikipati, D. K.
(2008). Clinical, Agricultural, and Evolutionary Biology of Myostatin: A Comparative Review. Endocr. Rev.
29: 513-534
[Abstract][Full Text]
Li, Z. B., Kollias, H. D., Wagner, K. R.
(2008). Myostatin Directly Regulates Skeletal Muscle Fibrosis. J. Biol. Chem.
283: 19371-19378
[Abstract][Full Text]
Sandri, M.
(2008). Signaling in Muscle Atrophy and Hypertrophy. Physiology
23: 160-170
[Abstract][Full Text]
Diel, P, Baadners, D, Schlupmann, K, Velders, M, Schwarz, J P
(2008). C2C12 myoblastoma cell differentiation and proliferation is stimulated by androgens and associated with a modulation of myostatin and Pax7 expression. J Mol Endocrinol
40: 231-241
[Abstract][Full Text]
Allen, D. L., Cleary, A. S., Speaker, K. J., Lindsay, S. F., Uyenishi, J., Reed, J. M., Madden, M. C., Mehan, R. S.
(2008). Myostatin, activin receptor IIb, and follistatin-like-3 gene expression are altered in adipose tissue and skeletal muscle of obese mice. Am. J. Physiol. Endocrinol. Metab.
294: E918-E927
[Abstract][Full Text]
Guo, W., Flanagan, J., Jasuja, R., Kirkland, J., Jiang, L., Bhasin, S.
(2008). The Effects of Myostatin on Adipogenic Differentiation of Human Bone Marrow-derived Mesenchymal Stem Cells Are Mediated through Cross-communication between Smad3 and Wnt/{beta}-Catenin Signaling Pathways. J. Biol. Chem.
283: 9136-9145
[Abstract][Full Text]
Kollias, H. D., McDermott, J. C.
(2008). Transforming growth factor-{beta} and myostatin signaling in skeletal muscle. J. Appl. Physiol.
104: 579-587
[Abstract][Full Text]
Manceau, M., Gros, J., Savage, K., Thome, V., McPherron, A., Paterson, B., Marcelle, C.
(2008). Myostatin promotes the terminal differentiation of embryonic muscle progenitors. Genes Dev.
22: 668-681
[Abstract][Full Text]
Nakatani, M., Takehara, Y., Sugino, H., Matsumoto, M., Hashimoto, O., Hasegawa, Y., Murakami, T., Uezumi, A., Takeda, S., Noji, S., Sunada, Y., Tsuchida, K.
(2008). Transgenic expression of a myostatin inhibitor derived from follistatin increases skeletal muscle mass and ameliorates dystrophic pathology in mdx mice. FASEB J.
22: 477-487
[Abstract][Full Text]
Nakano, N., Hori, H., Abe, M., Shibata, H., Arimura, T., Sasaoka, T., Sawabe, M., Chida, K., Arai, T., Nakahara, K.-i., Kubo, T., Sugimoto, K., Katsuya, T., Ogihara, T., Doi, Y., Izumi, T., Kimura, A.
(2007). Interaction of BMP10 with Tcap may modulate the course of hypertensive cardiac hypertrophy. Am. J. Physiol. Heart Circ. Physiol.
293: H3396-H3403
[Abstract][Full Text]
Kim, J.-s., Petrella, J. K., Cross, J. M., Bamman, M. M.
(2007). Load-mediated downregulation of myostatin mRNA is not sufficient to promote myofiber hypertrophy in humans: a cluster analysis. J. Appl. Physiol.
103: 1488-1495
[Abstract][Full Text]
Antony, N., Bass, J. J., McMahon, C. D., Mitchell, M. D.
(2007). Myostatin regulates glucose uptake in BeWo cells. Am. J. Physiol. Endocrinol. Metab.
293: E1296-E1302
[Abstract][Full Text]
Harridge, S. D. R.
(2007). Plasticity of human skeletal muscle: gene expression to in vivo function. Exp Physiol
92: 783-797
[Abstract][Full Text]
Takaoka, Y., Ohta, M., Ito, A., Takamatsu, K., Sugano, A., Funakoshi, K., Takaoka, N., Sato, N., Yokozaki, H., Arizono, N., Goto, S., Maeda, E.
(2007). Electroacupuncture suppresses myostatin gene expression: cell proliferative reaction in mouse skeletal muscle. Physiol. Genomics
30: 102-110
[Abstract][Full Text]
Artaza, J. N, Reisz-Porszasz, S., Dow, J. S, Kloner, R. A, Tsao, J., Bhasin, S., Gonzalez-Cadavid, N. F
(2007). Alterations in myostatin expression are associated with changes in cardiac left ventricular mass but not ejection fraction in the mouse. J Endocrinol
194: 63-76
[Abstract][Full Text]
Walsh, S., Metter, E. J., Ferrucci, L., Roth, S. M.
(2007). Activin-type II receptor B (ACVR2B) and follistatin haplotype associations with muscle mass and strength in humans. J. Appl. Physiol.
102: 2142-2148
[Abstract][Full Text]
Kim, Y. S., Bobbili, N. K., Lee, Y. K., Jin, H. J., Dunn, M. A.
(2007). Production of a Polyclonal Anti-Myostatin Antibody and the Effects of In Ovo Administration of the Antibody on Posthatch Broiler Growth and Muscle Mass. Poult. Sci.
86: 1196-1205
[Abstract][Full Text]
Garikipati, D. K., Gahr, S. A., Roalson, E. H., Rodgers, B. D.
(2007). Characterization of Rainbow Trout Myostatin-2 Genes (rtMSTN-2a and -2b): Genomic Organization, Differential Expression, and Pseudogenization. Endocrinology
148: 2106-2115
[Abstract][Full Text]
McKoy, G., Bicknell, K. A., Patel, K., Brooks, G.
(2007). Developmental expression of myostatin in cardiomyocytes and its effect on foetal and neonatal rat cardiomyocyte proliferation. Cardiovasc Res
74: 304-312
[Abstract][Full Text]
Pescatori, M., Broccolini, A., Minetti, C., Bertini, E., Bruno, C., D'amico, A., Bernardini, C., Mirabella, M., Silvestri, G., Giglio, V., Modoni, A., Pedemonte, M., Tasca, G., Galluzzi, G., Mercuri, E., Tonali, P. A., Ricci, E.
(2007). Gene expression profiling in the early phases of DMD: a constant molecular signature characterizes DMD muscle from early postnatal life throughout disease progression. FASEB J.
21: 1210-1226
[Abstract][Full Text]
Spuler, S., Kalbhenn, T., Zabojszcza, J., van Landeghem, F.K.H., Ludtke, A., Wenzel, K., Koehnlein, M., Schuelke, M., Ludemann, L., Schmidt, H. H.
(2007). Muscle and nerve pathology in Dunnigan familial partial lipodystrophy. Neurology
68: 677-683
[Abstract][Full Text]
Yang, W., Zhang, Y., Li, Y., Wu, Z., Zhu, D.
(2007). Myostatin Induces Cyclin D1 Degradation to Cause Cell Cycle Arrest through a Phosphatidylinositol 3-Kinase/AKT/GSK-3beta Pathway and Is Antagonized by Insulin-like Growth Factor 1. J. Biol. Chem.
282: 3799-3808
[Abstract][Full Text]
Amthor, H., Macharia, R., Navarrete, R., Schuelke, M., Brown, S. C., Otto, A., Voit, T., Muntoni, F., Vrbova, G., Partridge, T., Zammit, P., Bunger, L., Patel, K.
(2007). Lack of myostatin results in excessive muscle growth but impaired force generation. Proc. Natl. Acad. Sci. USA
104: 1835-1840
[Abstract][Full Text]
Mukherjee, A., Sidis, Y., Mahan, A., Raher, M. J., Xia, Y., Rosen, E. D., Bloch, K. D., Thomas, M. K., Schneyer, A. L.
(2007). FSTL3 deletion reveals roles for TGF-beta family ligands in glucose and fat homeostasis in adults. Proc. Natl. Acad. Sci. USA
104: 1348-1353
[Abstract][Full Text]
Castro-Gago, M., Gomez-Lado, C., Eiris-Punal, J., Carneiro, I., Arce, V. M., Devesa, J.
(2007). Muscle Myostatin Expression in Children With Muscle Diseases. J Child Neurol
22: 38-40
[Abstract]
Allen, D. L., Unterman, T. G.
(2007). Regulation of myostatin expression and myoblast differentiation by FoxO and SMAD transcription factors. Am. J. Physiol. Cell Physiol.
292: C188-C199
[Abstract][Full Text]
Solomon, A M, Bouloux, P M G
(2006). Modifying muscle mass - the endocrine perspective.. J Endocrinol
191: 349-360
[Abstract][Full Text]
Pearen, M. A., Ryall, J. G., Maxwell, M. A., Ohkura, N., Lynch, G. S., Muscat, G. E. O.
(2006). The Orphan Nuclear Receptor, NOR-1, Is a Target of {beta}-Adrenergic Signaling in Skeletal Muscle. Endocrinology
147: 5217-5227
[Abstract][Full Text]
Wilson, E. M., Rotwein, P.
(2006). Control of MyoD Function during Initiation of Muscle Differentiation by an Autocrine Signaling Pathway Activated by Insulin-like Growth Factor-II. J. Biol. Chem.
281: 29962-29971
[Abstract][Full Text]
Oudit, G.Y., Herzenberg, A.M., Kassiri, Z., Wong, D., Reich, H., Khokha, R., Crackower, M.A., Backx, P.H., Penninger, J.M., Scholey, J.W., Percy, M.J., Zhao Q., F. A., Harrison, C., Lappin, T.R., Maxwell, P.H., McMullin, M.F., Lee, F.S.
(2006). Angiotensin-Converting Enzyme-2 (ACE2)--A New Player in the Genesis of Glomerular Injury?: Loss of Angiotensin-Converting Enzyme-2 Leads to the Late Development of Angiotensin II-Dependent Glomerulosclerosis. Am J Pathol 168: 1808-1820, 2006. J. Am. Soc. Nephrol.
17: 2637-2643
[Full Text]
Garikipati, D. K, Gahr, S. A, Rodgers, B. D
(2006). Identification, characterization, and quantitative expression analysis of rainbow trout myostatin-1a and myostatin-1b genes.. J Endocrinol
190: 879-888
[Abstract][Full Text]
Mendias, C. L., Marcin, J. E., Calerdon, D. R., Faulkner, J. A.
(2006). Contractile properties of EDL and soleus muscles of myostatin-deficient mice. J. Appl. Physiol.
101: 898-905
[Abstract][Full Text]
Sato, F., Kurokawa, M., Yamauchi, N., Hattori, M.-a.
(2006). Gene silencing of myostatin in differentiation of chicken embryonic myoblasts by small interfering RNA. Am. J. Physiol. Cell Physiol.
291: C538-C545
[Abstract][Full Text]
Morissette, M. R., Cook, S. A., Foo, S., McKoy, G., Ashida, N., Novikov, M., Scherrer-Crosbie, M., Li, L., Matsui, T., Brooks, G., Rosenzweig, A.
(2006). Myostatin Regulates Cardiomyocyte Growth Through Modulation of Akt Signaling. Circ. Res.
99: 15-24
[Abstract][Full Text]
Welle, S., Bhatt, K., Pinkert, C. A.
(2006). Myofibrillar protein synthesis in myostatin-deficient mice. Am. J. Physiol. Endocrinol. Metab.
290: E409-E415
[Abstract][Full Text]
Yang, W., Chen, Y., Zhang, Y., Wang, X., Yang, N., Zhu, D.
(2006). Extracellular Signal-Regulated Kinase 1/2 Mitogen-Activated Protein Kinase Pathway Is Involved in Myostatin-Regulated Differentiation Repression. Cancer Res.
66: 1320-1326
[Abstract][Full Text]
Askanas, V., Engel, W. K.
(2006). Inclusion-body myositis: A myodegenerative conformational disorder associated with A{beta}, protein misfolding, and proteasome inhibition. Neurology
66: S39-S48
[Abstract][Full Text]
GEORGES, M., CLOP, A., MARCQ, F., TAKEDA, H., PIROTTIN, D., HIARD, S., TORDOIR, X., CAIMENT, F., MEISH, F., BIBE, B., BOUIX, J., ELSEN, J.M., EYCHENNE, F., LAVILLE, E., LARZUL, C., MILENKOVIC, D., TOBIN, J., CHARLIER, A. C.
(2006). Polymorphic Polymorphic MicroRNA-Target Interactions: A Novel Source of Phenotypic Variation. Cold Spring Harb Symp Quant Biol
71: 343-350
[Abstract]
Lee, S.-J., Reed, L. A., Davies, M. V., Girgenrath, S., Goad, M. E. P., Tomkinson, K. N., Wright, J. F., Barker, C., Ehrmantraut, G., Holmstrom, J., Trowell, B., Gertz, B., Jiang, M.-S., Sebald, S. M., Matzuk, M., Li, E., Liang, L.-f., Quattlebaum, E., Stotish, R. L., Wolfman, N. M.
(2005). Regulation of muscle growth by multiple ligands signaling through activin type II receptors. Proc. Natl. Acad. Sci. USA
102: 18117-18122
[Abstract][Full Text]
Womack, J. E.
(2005). Advances in livestock genomics: Opening the barn door. Genome Res
15: 1699-1705
[Abstract][Full Text]
Muenster, U., Harrison, C. A., Donaldson, C., Vale, W., Fischer, W. H.
(2005). An Activin-A/C Chimera Exhibits Activin and Myostatin Antagonistic Properties. J. Biol. Chem.
280: 36626-36632
[Abstract][Full Text]
Wenzel, K., Zabojszcza, J., Carl, M., Taubert, S., Lass, A., Harris, C. L., Ho, M., Schulz, H., Hummel, O., Hubner, N., Osterziel, K. J., Spuler, S.
(2005). Increased Susceptibility to Complement Attack due to Down-Regulation of Decay-Accelerating Factor/CD55 in Dysferlin-Deficient Muscular Dystrophy. J. Immunol.
175: 6219-6225
[Abstract][Full Text]
Huygens, W., Thomis, M. A. I., Peeters, M. W., Aerssens, J., Vlietinck, R., Beunen, G. P.
(2005). Quantitative trait loci for human muscle strength: linkage analysis of myostatin pathway genes. Physiol. Genomics
22: 390-397
[Abstract][Full Text]
Artaza, J. N., Bhasin, S., Magee, T. R., Reisz-Porszasz, S., Shen, R., Groome, N. P., Fareez, M. M., Gonzalez-Cadavid, N. F.
(2005). Myostatin Inhibits Myogenesis and Promotes Adipogenesis in C3H 10T(1/2) Mesenchymal Multipotent Cells. Endocrinology
146: 3547-3557
[Abstract][Full Text]
Chen, Y., Zajac, J. D, MacLean, H. E
(2005). Androgen regulation of satellite cell function. J Endocrinol
186: 21-31
[Abstract][Full Text]
Kim, J.-s., Cross, J. M., Bamman, M. M.
(2005). Impact of resistance loading on myostatin expression and cell cycle regulation in young and older men and women. Am. J. Physiol. Endocrinol. Metab.
288: E1110-E1119
[Abstract][Full Text]
Lionikas, A., Blizard, D. A., Gerhard, G. S., Vandenbergh, D. J., Stout, J. T., Vogler, G. P., McClearn, G. E., Larsson, L.
(2005). Genetic determinants of weight of fast- and slow-twitch skeletal muscle in 500-day-old mice of the C57BL/6J and DBA/2J lineage. Physiol. Genomics
21: 184-192
[Abstract][Full Text]
Bogdanovich, S., Perkins, K. J., Krag, T. O. B., Whittemore, L.-A., Khurana, T. S.
(2005). Myostatin propeptide-mediated amelioration of dystrophic pathophysiology. FASEB J.
19: 543-549
[Abstract][Full Text]
Wagner, K. R., Liu, X., Chang, X., Allen, R. E.
(2005). Muscle regeneration in the prolonged absence of myostatin. Proc. Natl. Acad. Sci. USA
102: 2519-2524
[Abstract][Full Text]
Varga, L., Pinke, O., Muller, G., Kovacs, B., Korom, E., Szabo, G., Soller, M.
(2005). Mapping a Syntenic Modifier on Mouse Chromosome 1 Influencing the Expressivity of the Compact Phenotype in the Myostatin Mutant (MstnCmpt-dl1Abc) Compact Mouse. Genetics
169: 489-493
[Abstract][Full Text]
Catipovic, B., Williams, M. S., Uhlenberg, B., Lucke, B., Schuelke, M.
(2004). Myostatin Mutation Associated with Gross Muscle Hypertrophy in a Child. NEJM
351: 1030-1031
[Full Text]
Sartorelli, V., Fulco, M.
(2004). Molecular and Cellular Determinants of Skeletal Muscle Atrophy and Hypertrophy. Sci Signal
2004: re11-re11
[Abstract][Full Text]