Immunoproliferative Small Intestinal Disease Associated with Campylobacter jejuni
Marc Lecuit, M.D., Ph.D., Eric Abachin, Ph.D., Antoine Martin, M.D., Claire Poyart, M.D., Ph.D., Philippe Pochart, Ph.D., Felipe Suarez, M.D., Djaouida Bengoufa, M.D., Ph.D., Jean Feuillard, M.D., Ph.D., Anne Lavergne, M.D., Jeffrey I. Gordon, M.D., Patrick Berche, M.D., Ph.D., Loïc Guillevin, M.D., and Olivier Lortholary, M.D., Ph.D.
Background Immunoproliferative small intestinal disease (alsoknown as alpha chain disease) is a form of lymphoma that arisesin small intestinal mucosa-associated lymphoid tissue (MALT)and is associated with the expression of a monotypic truncatedimmunoglobulin heavy chain without an associated light chain.Early-stage disease responds to antibiotics, suggesting a bacterialorigin. We attempted to identify a causative agent.
Methods We performed polymerase chain reaction (PCR), DNA sequencing,fluorescence in situ hybridization, and immunohistochemicalstudies on intestinal-biopsy specimens from a series of patientswith immunoproliferative small intestinal disease.
Results Analysis of frozen intestinal tissue obtained from anindex patient with immunoproliferative small intestinal diseasewho had a dramatic response to antibiotics revealed the presenceof Campylobacter jejuni. A follow-up retrospective analysisof archival intestinal-biopsy specimens disclosed campylobacterspecies in four of six additional patients with immunoproliferativesmall intestinal disease.
Conclusions These results indicate that campylobacter and immunoproliferativesmall intestinal disease are associated and that C. jejuni shouldbe added to the growing list of human pathogens responsiblefor immunoproliferative states.
Immunoproliferative small intestinal disease, also known asalpha chain disease, is a mucosa-associated lymphoid-tissue(MALT) lymphoma characterized by infiltration of the bowel wallwith a plasma-cell population that secretes a monotypic, truncatedimmunoglobulin heavy chain lacking an associated light chain.1,2,3Lymphoid infiltration leads to malabsorption and protein-losingenteropathy. The disease can cause a spectrum of histopathologicalchanges, ranging from seemingly benign lymphoid infiltrationto malignant diffuse large-B-cell lymphoma.
Since its initial description,1 immunoproliferative small intestinaldisease has largely been reported in the Mediterranean basin,the Middle East, the Far East, and Africa. In the Middle East,the most common site of extranodal lymphoma is the gastrointestinaltract: immunoproliferative small intestinal disease accountsfor approximately one third of gastrointestinal lymphomas.4The restricted geographic distribution of the disease has ledto the hypothesis that environmental factors may have a pathogenicrole.
Remarkably, early-stage immunoproliferative small intestinaldisease typically responds to antibiotics, suggesting that itmay be triggered by bacterial infection.5,6 However, previousattempts to identify a causative agent with the use of standardculture methods have failed.5,6,7 Immunoproliferative smallintestinal disease shares histopathological features with gastricMALT lymphoma associated with Helicobacter pylori infection,2,3and a case report suggested that H. pylori may be a potentialcausative agent.8 However, this proposal was not supported bythe results of a subsequent retrospective study of 21 patientswith immunoproliferative small intestinal disease.9 We useda molecular strategy similar to that used to identify the causativeagents of bacillary angiomatosis (Bartonella henselae)10 andWhipple's disease (Tropheryma whipplei),11 in order to determinewhether immunoproliferative small intestinal disease could belinked to specific bacterial species.
Case Reports
Index Patient
A 45-year-old woman from Cameroon was hospitalized for a 12-month-longillness characterized by chronic diarrhea and wasting. Histologicexamination of endoscopic biopsy specimens from her duodenumand proximal jejunum revealed massive infiltration of the laminapropria, with a dimorphic population of plasma cells locatedin the superficial mucosa and centrocyte-like lymphocytes proliferatingdeeper in the mucosa, mostly around crypts (Figure 1A, Figure 1B,Figure 1C, and Figure 1D). Infiltration of the lamina propriawas less pronounced in antral-biopsy specimens.
Figure 1. Histologic and Immunohistologic Studies of Endoscopic-Biopsy Specimens from the Index Patient.
In Panel A, staining with hematoxylin and eosin shows lymphoid infiltration of the lamina propria in a section of jejunum (x50). In Panel B, a section of the antral region of the stomach stained with hematoxylin and eosin shows lymphoid infiltration of the lamina propria (x100). In Panel C, which shows a higher-power view of the specimen in Panel A, the typical lymphoplasmacytic features of the superficial mucosa infiltrate are evident (hematoxylin and eosin, x1000). In Panel D, a higher-power view of the specimen shown in Panel A reveals centrocyte-like cells infiltrating the crypt epithelium (hematoxylin and eosin, x400). Sections of jejunum (Panel E) and stomach (Panel F) stained with primary antibodies directed against the B-cell marker CD20 (appears brown when stained with enzyme-linked secondary antibodies) and counterstained with hematoxylin (x100) show CD20-positive centrocyte-like lymphocytes pervading the lamina propria surrounding crypts (bottom insets show higher-power views of boxed areas, x300). CD20-positive centrocyte-like lymphocytes infiltrate the crypt epithelium and produce characteristic lymphoepithelial lesions (arrows in Panels E and F). In contrast, the superficial plasma-cell infiltrate is negative for CD20. The inset in the upper right-hand portion of Panel F shows a section stained with KL1 (which recognizes cytokeratin) and counterstained with hematoxylin (x300). Cross-sectioned crypts contain brown, cytokeratin-positive epithelial cells. Jejunal sections (x400) were incubated with monoclonal antibodies that recognize the heavy chain (Panel G), heavy chain (Panel H), light chain (Panel I), or light chain (Panel J) and were counterstained with hematoxylin. The results establish that the infiltrating lymphoid-cell population (lymphoplasmacytes and centrocyte-like cells) expresses the heavy chain without its associated light chain.
Immunohistochemical studies of these biopsy specimens showedthat the plasma cells were negative for CD20, whereas the centrocyte-likelymphocytes were positive for CD20 (Figure 1E and Figure 1F).The cytoplasm of both plasma cells and centrocyte-like lymphocytesshowed intense staining for immunoglobulin heavy chain, withno detectable expression of light chains or surface immunoglobulinin these cells (Figure 1G, Figure 1H, Figure 1I, and Figure 1J).Centrocyte-like lymphocytes were responsible for the lymphoepitheliallesions that are typical of MALT lymphomas (Figure 1D, Figure 1E,and Figure 1F).
Staining of gastric- and intestinal-biopsy specimens with Giemsaand silver stains and serologic assays were all negative forH. pylori. Tissue and stool cultures were negative for salmonella,yersinia, shigella, and campylobacter. An enzyme-linked immunosorbentassay and Western blot assays of serum were positive for Campylobacterjejuni (data not shown).
Analysis of blood samples disclosed 7560 lymphocytes per cubicmillimeter, with the vast majority having morphologic featuresof lymphoplasmacytes. Analysis with the use of a fluorescence-activatedcell sorter established that 82 percent of peripheral-bloodlymphocytes were CD19+, CD20, CD38+, CD138 B cells.Immunocytochemical studies of the sorted cells revealed highlevels of cytoplasmic heavy chains without detectable lightchains or surface immunoglobulin. Bone marrow biopsy disclosedextensive infiltration with lymphoplasmacytes. Evidence of theclonality of this population was provided by Southern blot analysisof peripheral-blood lymphocyte DNA, which showed discrete rearrangementsof the genes for the immunoglobulin heavy-chain and light-chainloci (data not shown). The serum IgA level was increased to10.9 g per liter (normal range, 0.76 to 3.90), whereas IgG andIgM levels were decreased (to 5.81 and 0.22 g per liter, respectively).Immunoelectrophoresis of serum, aspirated jejunal luminal contents,and urine from the patient showed a prominent arc of heavychain precipitin (Figure 2A). Western blot analysis of serumrevealed the presence of a truncated monotypic 1 heavy chain.
Figure 2. Resolution of Immunoproliferative Small Intestinal Disease in the Index Patient after Antimicrobial Therapy.
Panel A shows the immunoelectrophoresis of serum before and after antibiotic treatment; the arrow points to the prominent arc of heavy chain precipitin observed before treatment. Panel B shows the time course of the disappearance of the CD19+, CD38+, and heavy chain (HC)positive leukemic cells, as assessed by analysis of peripheral-blood lymphocytes with the use of a fluorescence-activated cell sorter. Panel C shows the gradual decrease in the serum level of total IgA.
On the basis of these clinical, histopathological, and immunologicfindings, a diagnosis of immunoproliferative small intestinaldisease was made. Given the gastric extension of the disease,the phenotypic similarities between the disease and H. pyloriassociatedgastric MALT lymphoma,2,3 and a previous case report of regressionof immunoproliferative small intestinal disease in a patientafter the eradication of H. pylori infection,8 triple antimicrobialtherapy was initiated (1 g of amoxicillin twice daily, 500 mgof metronidazole twice daily, and 500 mg of clarithromycin twicedaily) in combination with a proton-pump inhibitor (20 mg ofomeprazole twice daily). The diarrhea subsided within a week,the leukemic component disappeared within 10 weeks (Figure 2B),and there was progressive resolution of the paraproteinemia(Figure 2A and Figure 2C) and intestinal lymphoplasmacytic infiltrate(data not shown). Treatment was stopped after five months becausethe patient was asymptomatic, the leukemic and serum paraproteinabnormalities had disappeared, and lymphoplasmacytic infiltrationof the intestine was barely detectable in follow-up endoscopicbiopsy specimens from the jejunum. One year after the diagnosishad been established, the results of clinical examination andlaboratory studies were normal.
Six Additional Patients
Immunoproliferative small intestinal disease is rare. Frozenintestinal samples from other patients with untreated immunoproliferativesmall intestinal disease were not available to us. Therefore,we retrieved archival paraffin-embedded excisional jejunal-biopsyspecimens obtained at the time of laparoscopy 8 to 27 yearsearlier from six additional patients in whom immunoproliferativesmall intestinal disease had been diagnosed at a single hospitalaccording to established histopathological and immunologic criteria.1,5,6,12
Methods
Tissue Samples
We analyzed tissue specimens from six sources. Frozen and formalin-fixed,paraffin-embedded specimens were obtained from gastric, duodenal,and jejunal biopsies performed endoscopically in the index patientone day before and eight days after the initiation of antimicrobialtherapy. Archival jejunal-biopsy specimens, which had been fixedin Bouin's fluid and embedded in paraffin, were obtained fromsix additional patients who had received a diagnosis of immunoproliferativesmall intestinal disease. Formalin-fixed, paraffin-embeddedjejunal-biopsy specimens were obtained endoscopically from apatient infected with human immunodeficiency virus (HIV) whohad acute C. jejuni enteritis. Formalin-fixed, paraffin-embeddedstomach samples were obtained from a patient with H. pylorigastritis. Frozen duodenal-biopsy specimens were obtained from10 patients with chronic diarrhea of unknown origin (as definedby negative cultures for known enteropathogens). Formalin-fixed,paraffin-embedded duodenal-biopsy specimens were obtained from10 patients who were being evaluated for anemia.
Bacterial Strains and Antibodies
We obtained C. jejuni reference strain CIP 70.2, H. pylori referencestrain CIP 103995, and Escherichia coli reference strain CIP7624 from the Institut Pasteur collection. Two mouse monoclonalantibodies were used for immunohistochemical studies: IgG2bNCL-C-JEJUNI (Novocastra), which recognizes a flagellar immunologicdeterminant common to C. jejuni and H. pylori,13 and IgM CP1/IIG10(Biotrend), which is directed against a 43-kD, nonsurface-associatedH. pylori antigen that is not detectable in other helicobacterspecies or unrelated bacteria.
Polymerase Chain Reaction
Universal primers PB (5'TAACACATGCAAGTCGAACG3') and DG74 (5'AGGAGGTGATCCAACCGCA3')were used to amplify bacterial 16S ribosomal DNA (rDNA).14 Establishedprimers directed at C. jejuni (CCCJ609F 5'AATCTAATGGCTTAACCATTA3'and CCJ1442R 5'GTAACTAGTTTAGTATTCCGG3')15 were used to generatean 852-bp 16S rDNA amplicon. Primers specific for H. pylori(5'fla 5'CCACGGTTAAAGCGTCTATTGG3' and 3'fla 5'GATCGCATTAGTCAACCTCCCG3')16were used to amplify a 401-bp fragment from the flaB gene. Twopairs of primers 72/96F (5'ACAGGAAGAAGCTTGCTTCTTTGC3')and 455/477R (5'GAGCAAAGGTATTAACTTTACTCCC3') and 455/477F (5'GGGAGTAAAGTTAATACCTTTGCTC3')and 1000/1025R (5'ACATTCTCATCTCTGAAAACTTCCG3') weredesigned to amplify 16S rDNA from Enterobacteriaceae. Cyclingconditions for all polymerase chain reactions (PCRs) were asfollows: 7 minutes at 95°C, 35 cycles of denaturation for30 seconds at 95°C, annealing for 20 seconds at 55°C,and 2 minutes of extension at 72°C and then 10 minutes at72°C.
The specificity of the PCR assays was initially establishedwith the use of DNA extracted from the three reference strainslisted above (Table 1). For the index patient, amplicons from16S ribosomal genes were subcloned, and the nucleotide sequencesof 12 randomly chosen clones were determined on both strands.All 16S rDNA sequences that were at least 99 percent homologouswere considered to belong to the same species.17,18
Table 1. Results of Polymerase-Chain-Reaction (PCR) Assays of Biopsy Specimens from the Index Patient with Immunoproliferative Small Intestinal Disease and Control Samples.
Fluorescence in Situ Hybridization
Cy3-tagged 5'ATTACTGAGATGACTAGCACCCC3' (Cj-490) was used toprobe for the presence of C. jejuni,19 whereas Cy3-tagged 5'CACACCTGACTGACTATCCCG3'(Hpy-1) was used to detect H. pylori.20 Deparaffinized, formalin-fixedsections that were 5 µm thick were incubated for 10 minutesin lysozyme buffer (10 mg of lysozyme per milliliter [Sigma],100 mM TRIShydrochloric acid [pH 8], and 50 mM EDTA)at room temperature and then for 2 hours at 35°C in hybridizationchambers with the oligonucleotide probe (diluted to a finalconcentration of 4.5 ng per microliter in a solution of 30 percentformamide, 0.9 M sodium chloride, 20 mM TRIShydrochloricacid [pH 8], and 0.01 percent sodium dodecyl sulfate). Tissuesections were washed twice (for 15 minutes at 37°C per cycle)in wash buffer (0.9 M sodium chloride, 20 mM TRIShydrochloricacid [pH 8], 5 mM EDTA, and 0.01 percent sodium dodecyl sulfate)and once in distilled water, dried at room temperature, mounted,and observed by means of epifluorescence microscopy.
All tissue samples studied were collected as part of routinecare. The National Ethics Committee of France requires neitherapproval by institutional review boards nor informed consentfor this type of research to be conducted.
Results
Identification of C. jejuni DNA
DNA was extracted from frozen jejunal- and gastric-biopsy specimensfrom the index patient. Initial PCR assays of these DNAs wereperformed with the use of well-established universal primersknown to generate amplicons from the 16S rDNA genes from mostphyla in the bacteria superkingdom.14 Amplicons were producedin assays in which the DNA template was extracted from frozenjejunal samples harvested one day before treatment was initiated.In contrast, no amplicons were produced with the use of DNAprepared from material harvested eight days after therapy wasstarted.
The nucleotide sequences of 8 of 12 cloned amplicons generatedfrom the pretreatment preparation of jejunal DNA were 99.6 percentidentical to 16S rDNA amplified from DNA of the C. jejuni referencestrain. Computer searches of GenBank with the use of the BLASTprogram (http://www.ncbi.nlm.nih.gov/blast/) and the 16S rDNAdata base (http://greengenes.llnl.gov/16S/) showed that thefour remaining sequences were from abiotrophia, neisseria, lactococcus,and haemophilus. Members of these four genera are part of thenormal oropharyngeal microbiota in humans.
Follow-up PCR studies with the use of primers directed at C.jejuni 16S rDNA yielded amplicons of the expected size fromantral, jejunal, and fecal DNAs prepared from material obtainedbefore the initiation of antimicrobial therapy (Table 1). Assaysof the same DNAs with the use of primers directed at H. pylori16S rDNA or primers that recognize 16S rDNA from members ofthe Enterobacteriaceae family were all negative (Table 1). Inaddition, the PCR assay was negative with the use of primersdirected at C. jejuni and DNA prepared from jejunal- and gastric-biopsyspecimens obtained from the index patient eight days after theinitiation of antibiotic treatment and from DNA extracted fromfrozen proximal intestinal-biopsy specimens from 10 controlpatients with diarrhea of unknown origin (i.e., not associatedwith cultivatable enteropathogens) (Table 1).
The results of sequencing 16S rDNA amplicons obtained with universalbacterial 16S rDNA primers and the C. jejunidirectedPCR assays of endoscopic biopsy specimens from the index patientand controls provided initial evidence of an association betweenthis campylobacter species and immunoproliferative small intestinaldisease.
Detection of Campylobacter jejuni in Small Intestinal Tissue
To provide further evidence of the presence of C. jejuni inthe index patient, we developed a fluorescence in situ hybridization(FISH) assay using an oligonucleotide probe directed at C. jejuni16S rRNA. The sensitivity and specificity of the FISH assaywere established as follows: staining with the Cy3-labeled oligonucleotidewas readily detectable in a smear of cultured C. jejuni (Figure 3A),intraluminal C. jejuni were detected in a jejunal-biopsyspecimen from an HIV-infected patient with culture-documentedC. jejuni enteritis (Table 2), and no signal was noted in gastric-biopsyspecimens from a patient with H. pylori gastritis (Table 2 andFigure 3B).
Figure 3. Fluorescence in Situ Hybridization (FISH) and Immunohistochemical Analysis of Tissue Specimens.
Panel A shows a positive control for FISH: the Cy3-labeled oligonucleotide probe directed against Campylobacter jejuni and a smear of cultured C. jejuni type strain (x400). Panels B and C show the specificity of the FISH assay; the C. jejunidirected probe or a Helicobacter pylorispecific probe and sections of a gastric-biopsy specimen from a patient with H. pyloriassociated gastritis were used for FISH (x400). The C. jejuni probe does not recognize H. pylori (Panel B), whereas the H. pylori probe produces a prominent signal (Panel C). Panels D, E, F, and G show the results of FISH analysis with the use of the C. jejuni probe and sections prepared from biopsy specimens of the proximal small intestine (Panel D) and antrum (Panel F) obtained from the index patient before the initiation of antimicrobial therapy. After hybridization, sections were demounted and stained with hematoxylin and eosin (Panels E and G). Prominent signals are seen in the lamina propria and surrounding blood vessels (arrows in Panels D, E, F, and G) (x400). Panels H, I, J, K, L, and M show immunohistochemical analysis of jejunal sections stained with NCL-C-JEJUNI monoclonal antibody (appears brown when stained with enzyme-linked secondary antibodies) and hematoxylin (x400). The arrows point to immunolabeled material shown at a higher magnification in the bottom insets in the six panels (x800). Panel H shows a specimen from a patient infected with human immunodeficiency virus who had acute C. jejuni enteritis. Bacteria are present in the lumen and are associated with enterocytes. Panel I shows a specimen from the index patient. Panels J, K, and L show archival biopsy specimens from three patients with immunoproliferative small intestinal disease (Patients 1, 2, and 3 in Table 2) that are positive for C. jejuni on FISH. The top insets in these three panels show sections with intraluminal immunolabeled bacteria (x400). Panel M shows a biopsy specimen from a patient with immunoproliferative small intestinal disease (Patient 6 in Table 2) that was negative for C. jejuni on FISH.
Table 2. Results of Fluorescence in Situ Hybridization and Immunohistochemical Assays of Biopsy Specimens from the Index Patient, Six Other Patients with Immunoproliferative Small Intestinal Disease, and Controls.
Subsequent FISH analysis with the C. jejuni probe revealed theorganism in sections of jejunal- and stomach-biopsy specimensobtained from the index patient before the initiation of antimicrobialtherapy. The organism was most prominent in the lamina propria,often in the vicinity of capillaries (Figure 3D, Figure 3E,Figure 3F, and Figure 3G), a finding consistent with the observedtropism of this organism in an animal model of infection.21A control H. pylorispecific FISH probe (Figure 3C) didnot produce a signal (Table 2), a finding that is consistentwith the negative Giemsa and silver staining and the PCR results(Table 1).
Finally, immunohistochemical methods were used to confirm thepresence of C. jejuni in the index patient. Two well-characterized,commercially available preparations of monoclonal antibody wereused: one recognizes a flagellar immunologic determinant sharedby C. jejuni and H. pylori (NCL-C-JEJUNI), and another is specificfor an H. pylori epitope (CP1/IIG10). Control experiments thatused sections of jejunum from an HIV-infected patient with culture-positiveacute C. jejuni enteritis disclosed a prominent signal withNCL-C-JEJUNI and no signal with the H. pylorispecificmonoclonal antibody (Figure 3H and Table 2). Assays of sectionsprepared from jejunal- and gastric-biopsy specimens obtainedbefore the index patient started antimicrobial therapy disclosedreadily detectable signals in the lamina propria with NCL-C-JEJUNIbut not with the H. pylorispecific antibody (Figure 3Iand Table 2). Together, these results support the conclusionthat C. jejuni was present at the sites of gut abnormalitiesin the index patient and rule out the possibility of concomitantH. pylori infection.
Analysis of Archival Tissues
We were unable to recover amplifiable DNA from any of the archivalsamples from six patients with immunoproliferative small intestinaldisease that is, the PCRs for the human -actin geneas well as for C. jejuni 16S rDNA were all negative. This failuremost likely reflects the method of fixation together with theage of the samples. However, because material fixed with Bouin'sfluid is known to be suitable for FISH,22,23 these biopsy specimenswere analyzed with the use of three probes: a universal bacterial16S rDNA oligonucleotide (positive control for the presenceof bacteria), the probe directed at C. jejuni, and the specificprobe for H. pylori. The bacterial FISH probe was positive insamples from five of the six patients (Patients 1 through 5in Table 2). The C. jejunidirected probe produced a positivesignal in three of the six biopsy specimens from these patients(Patients 1, 2, and 3 in Table 2).
In addition, the two monoclonal antibodies were used to confirmthat C. jejuni immunologic determinants were present in allthree FISH-positive samples (Figure 3J, Figure 3K, and Figure 3L),as well as in one FISH-negative sample (Figure 3M and Table 2).No signal was detected with these monoclonal antibodiesin the 10 control duodenal samples. Moreover, the H. pylorispecificFISH probe and monoclonal antibody did not detect this speciesin any of the archival jejunal-biopsy specimens from the sixpatients with immunoproliferative small intestinal disease (Table 2).
Discussion
Previous attempts to link a bacterial species to immunoproliferativesmall intestinal disease with the use of culture-based approacheshave failed.5,6,7 We used a molecular approach to establisha link between immunoproliferative small intestinal diseaseand C. jejuni infection in an index patient. This associationis based on three observations. First, a PCR assay with theuse of universal bacterial 16S rDNA primers and DNA templatesprepared from biopsy specimens of the proximal small intestineobtained before the initiation of antimicrobial treatment inthe index patient yielded amplicons encompassing the entire16S rDNA gene that were identified as C. jejuni by sequencing.No other enteropathogen was detected by PCR. Second, FISH andimmunohistochemical analyses showed C. jejuni in diseased biopsyspecimens of the small intestine. Third, the eradication ofC. jejuni with antimicrobial therapy was associated with rapidremission of the immunoproliferative small intestinal disease(i.e., resolution of both diarrhea and lymphoplasmacytic infiltrationof the intestine and the disappearance of the leukemic componentand the monotypic truncated immunoglobulin heavy chain in serum).
Further support for an association between C. jejuni and immunoproliferativesmall intestinal disease is provided by four additional observations.Our retrospective study of a monocentric series of archivalbiopsy specimens yielded four additional cases of campylobacter-associateddisease among six patients with immunoproliferative small intestinaldisease. Puri et al. described a patient in whom culture-positiveC. jejuni diarrhea developed two to three days after the initiationof antineoplastic chemotherapy for immunoproliferative smallintestinal disease24 a sequence of events that suggeststhat chemotherapy exacerbated a preexisting C. jejuni infection.Immunoproliferative small intestinal disease occurs almost exclusivelyin developing countries where C. jejuni infection is hyperendemic,often chronic, and asymptomatic.5,25,26,27 Finally, antimicrobialregimens reported to be effective in treating the disease arealso active against C. jejuni infection.5,6,7
Our FISH and immunohistochemical studies detected C. jejuniin biopsy specimens of the small intestine and stomach fromthe index patient but not in biopsy specimens of the intestinallumen. This result is in agreement with the negative stool culturesand may account for the failure of previous studies to linkimmunoproliferative small intestinal disease with this organismwith the use of standard culture-based studies.5,6,7 Moreover,C. jejuni is microaerophilic and may exist in a viable but noncultivatablestate.28
Our results do not allow us to conclude that C. jejuni is theonly bacterial species associated with immunoproliferative smallintestinal disease. Nonetheless, C. jejuni should be added tothe growing list of human pathogens responsible for chronicinfection that are also implicated in antigen-driven immunoproliferativestates.29,30,31 The association of C. jejuni with immunoproliferativesmall intestinal disease is reminiscent of the link betweenH. pylori infection and gastric MALT lymphoma.29,30 However,in contrast to a previous case report8 and in agreement witha more recent study based on a series of 21 cases,9 we foundno evidence that H. pylori is involved in the development ofimmunoproliferative small intestinal disease.
C. jejuni has been shown to persist in Peyer's patches and mesentericlymph nodes in a gnotobiotic mouse model32 and to secrete atoxin, CdtB, that mediates DNA damage.33 These properties couldbe critical in the pathogenesis of immunoproliferative smallintestinal disease. C. jejuni can elicit a strong IgA mucosalresponse, and chronic infection with C. jejuni leads to sustainedstimulation of the mucosal immune system.26 This persistentstimulation could eventually lead to the expansion of IgA-secretingclones and to the selection of a clone that secretes heavychains that has eluded antibody-antigen Fc-dependent down-regulation.34,35Eradication of the antigenic source with antimicrobial treatmentmay stop the proliferation of this lymphoplasmacytic population.
As is true for H. pyloriassociated gastric MALT lymphomas,a better understanding of the role of C. jejuni in the pathogenesisof immunoproliferative small intestinal disease will requirefurther analysis of mechanisms and the development of suitableanimal models. The identification of an association betweenC. jejuni and immunoproliferative small intestinal disease maylead to improvements in the diagnosis, management, and preventionof this disease, at least in a subgroup of patients.
Supported by grants from the Programme de Recherche Fondamentaleen Microbiologie, Maladies Infectieuses et Parasitaires, Ministèrede l'Education Nationale de la Recherche et de la Technologie.
We are indebted to Hélène Poirel for Southernblot analysis, to Pierre Aucouturier for Western blot studies,to Jean-Louis Fauchère for C. jejuni and H. pylori serologicanalyses, and to Jean-Claude Rambaud for assistance in retrievingarchival biopsy materials and for helpful discussions.
Source Information
From Hôpital Avicenne (M.L., A.M., F.S., J.F., L.G., O.L.), Institut Pasteur (M.L., O.L.), Hôpital Necker (E.A., C.P., P.B.), Conservatoire National des Arts et Métiers (P.P.), Hôpital Saint-Louis (D.B.), and Hôpital Lariboisière (A.L.) all in Paris; and Washington University School of Medicine, St. Louis (J.I.G.).
Address reprint requests to Dr. Lecuit at the Service des Maladies Infectieuses et Tropicales, Hôpital NeckerEnfants Malades, Université Paris V, 149 rue de Sèvres, 75743 Paris CEDEX 15, France, or at mlecuit{at}pasteur.fr.
References
Seligmann M, Danon F, Hurez D, Mihaesco E, Preud'homme JL. Alpha-chain disease: a new immunoglobulin abnormality. Science 1968;162:1396-1397. [Free Full Text]
Isaacson P, Wright DH. Malignant lymphoma of mucosa-associated lymphoid tissue: a distinctive type of B-cell lymphoma. Cancer 1983;52:1410-1416. [CrossRef][Web of Science][Medline]
Isaacson PG, Dogan A, Price SK, Spencer J. Immunoproliferative small-intestinal disease: an immunohistochemical study. Am J Surg Pathol 1989;13:1023-1033. [Medline]
Salem P, Anaissie E, Allam C, et al. Non-Hodgkin's lymphomas in the Middle East: a study of 417 patients with emphasis on special features. Cancer 1986;58:1162-1166. [CrossRef][Medline]
Rambaud J-C, Brouet J-C, Seligmann M. Alpha chain disease and related lymphoproliferative disorders. In: Ogra PL, Mestecky J, Lamm ME, Strober W, McGhee JR, Bienenstock J, eds. Handbook of mucosal immunology. San Diego, Calif.: Academic Press, 1994:425-33.
Harzic M, Girard-Pipau F, Halphen M, Ferchal F, Pérol Y, Rambaud J-C. Étude bactériologique, parasitologique et virologique de la flore digestive dans la maladie des chaînes alpha. Gastroenterol Clin Biol 1985;9:472-479. [Medline]
Fischbach W, Tacke W, Greiner A, Konrad H, Müller-Hermelink. Regression of immunoproliferative small intestinal disease after eradication of Helicobacter pylori. Lancet 1997;349:31-32. [Medline]
Malekzadeh R, Kaviani MJ, Tabei SZ, Abdolhadi B, Haghshenas M, Navab F. Lack of association between Helicobacter pylori infection and immunoproliferative small intestinal disease. Arch Iran Med 1999;2:1-4.
Relman DA, Loutit JS, Schmidt TM, Falkow S, Tompkins LS. The agent of bacillary angiomatosis: an approach to the identification of uncultured pathogens. N Engl J Med 1990;323:1573-1580. [Abstract]
Relman DA, Schmidt TM, MacDermott RP, Falkow S. Identification of the uncultured bacillus of Whipple's disease. N Engl J Med 1992;327:293-301. [Abstract]
Galian A, Lecestre MJ, Scotto J, Bognel C, Matuchansky C, Rambaud JC. Pathological study of alpha-chain disease, with special emphasis on evolution. Cancer 1977;39:2081-2101. [Medline]
Newell DG. Monoclonal antibodies directed against the flagella of Campylobacter jejuni: production, characterization and lack of effect on the colonization of infant mice. J Hyg (Lond) 1986;96:131-141. [Medline]
Greisen K, Loeffelholz M, Purohit A, Leong D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol 1994;32:335-351. [Free Full Text]
Linton D, Lawson AJ, Owen RJ, Stanley J. PCR detection, identification to species level, and fingerprinting of Campylobacter jejuni and Campylobacter coli direct from diarrheic samples. J Clin Microbiol 1997;35:2568-2572. [Abstract]
Suerbaum S, Josenhans C, Labigne A. Cloning and genetic characterization of the Helicobacter pylori and Helicobacter mustelae flaB flagellin genes and construction of H. pylori flaA- and flaB-negative mutants by electroporation-mediated allelic exchange. J Bacteriol 1993;175:3278-3288. [Free Full Text]
Kwok AY, Su SC, Reynolds RP, et al. Species identification and phylogenetic relationships based on partial HSP60 gene sequences within the genus Staphylococcus. Int J Syst Bacteriol 1999;49:1181-1192. [Free Full Text]
Rossello-Mora R, Amann R. The species concept for prokaryotes. FEMS Microbiol Rev 2001;25:39-67. [Web of Science][Medline]
Waller DF, Ogata SA. Quantitative immunocapture PCR assay for detection of Campylobacter jejuni in foods. Appl Environ Microbiol 2000;66:4115-4118. [Free Full Text]
Trebesius K, Panthel K, Strobel S, et al. Rapid and specific detection of Helicobacter pylori macrolide resistance in gastric tissue by fluorescent in situ hybridisation. Gut 2000;46:608-614. [Free Full Text]
Boosinger TR, Powe TA. Campylobacter jejuni infections in gnotobiotic pigs. Am J Vet Res 1988;49:456-458. [Medline]
Weiss LM, Chen YY. Effects of different fixatives on detection of nucleic acids from paraffin-embedded tissues by in situ hybridization using oligonucleotide probes. J Histochem Cytochem 1991;39:1237-1242. [Abstract]
Montone KT, Litzky LA. Rapid method for detection of Aspergillus 5S ribosomal RNA using a genus-specific oligonucleotide probe. Am J Clin Pathol 1995;103:48-51. [Medline]
Puri AS, Aggarwal R, Khan EM, et al. Explosive Campylobacter jejuni diarrhea in immunoproliferative small intestinal disease. Indian J Gastroenterol 1992;11:141-143. [Medline]
Ponka A, Pitkanen T, Sarna S, Kosunen TU. Infection due to Campylobacter jejuni: a report of 524 outpatients. Infection 1984;12:175-178. [CrossRef][Web of Science][Medline]
Skirrow MB, Blaser MJ. Campylobacter jejuni. In: Blaser MJ, Smith PD, Ravdin JI, Greenberg HB, Guerrant RL, eds. Infections of the gastrointestinal tract. New York: Raven Press, 1995:825-48.
Coker AO, Isokpehi RD, Thomas BN, Amisu KO, Obi CL. Human campylobacteriosis in developing countries. Emerg Infect Dis 2002;8:237-244. [Web of Science][Medline]
Rollins DM, Colwell RR. Viable but nonculturable stage of Campylobacter jejuni and its role in survival in the natural aquatic environment. Appl Environ Microbiol 1986;52:531-538. [Free Full Text]
Wotherspoon AC, Doglioni C, Diss TC, et al. Regression of primary low-grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after eradication of Helicobacter pylori. Lancet 1993;342:575-577. [CrossRef][Web of Science][Medline]
Hussell T, Isaacson PG, Crabtree JE, Spencer J. The response of cells from low-grade B-cell gastric lymphomas of mucosa-associated lymphoid tissue to Helicobacter pylori. Lancet 1993;342:571-574. [CrossRef][Web of Science][Medline]
Pagano JS. Viruses and lymphomas. N Engl J Med 2002;347:78-79. [Free Full Text]
Fauchere JL, Veron M, Lellouch-Tubiana A, Pfister A. Experimental infection of gnotobiotic mice with Campylobacter jejuni: colonisation of intestine and spread to lymphoid and reticulo-endothelial organs. J Med Microbiol 1985;20:215-224. [Free Full Text]
Lara-Tejero M, Galan JE. A bacterial toxin that controls cell cycle progression as a deoxyribonuclease I-like protein. Science 2000;290:354-357. [Free Full Text]
Yodoi J, Adachi M, Noro N. IgA binding factors and Fc receptors for IgA: comparative studies between IgA and IgE Fc receptor systems. Int Rev Immunol 1987;2:117-141. [Medline]
Howard, S. L., Jagannathan, A., Soo, E. C., Hui, J. P. M., Aubry, A. J., Ahmed, I., Karlyshev, A., Kelly, J. F., Jones, M. A., Stevens, M. P., Logan, S. M., Wren, B. W.
(2009). Campylobacter jejuni Glycosylation Island Important in Cell Charge, Legionaminic Acid Biosynthesis, and Colonization of Chickens. Infect. Immun.
77: 2544-2556
[Abstract][Full Text]
Purdue, M. P., Lan, Q., Wang, S. S., Kricker, A., Menashe, I., Zheng, T.-Z., Hartge, P., Grulich, A. E., Zhang, Y., Morton, L. M., Vajdic, C. M., Holford, T. R., Severson, R. K., Leaderer, B. P., Cerhan, J. R., Yeager, M., Cozen, W., Jacobs, K., Davis, S., Rothman, N., Chanock, S. J., Chatterjee, N., Armstrong, B. K.
(2009). A pooled investigation of Toll-like receptor gene variants and risk of non-Hodgkin lymphoma. Carcinogenesis
30: 275-281
[Abstract][Full Text]
(2009). Image of the Month--Diagnosis. Arch Surg
144: 88-88
[Full Text]
Tuomisto, A., Sund, M., Tahkola, J., Latvanlehto, A., Savolainen, E.-R., Autio-Harmainen, H., Liakka, A., Sormunen, R., Vuoristo, J., West, A., Lahesmaa, R., Morse, H. C. III, Pihlajaniemi, T.
(2008). A Mutant Collagen XIII Alters Intestinal Expression of Immune Response Genes and Predisposes Transgenic Mice to Develop B-Cell Lymphomas. Cancer Res.
68: 10324-10332
[Abstract][Full Text]
Jaffe, E. S., Harris, N. L., Stein, H., Isaacson, P. G.
(2008). Classification of lymphoid neoplasms: the microscope as a tool for disease discovery. Blood
112: 4384-4399
[Abstract][Full Text]
Tu, Q. V., McGuckin, M. A., Mendz, G. L.
(2008). Campylobacter jejuni response to human mucin MUC2: modulation of colonization and pathogenicity determinants. J Med Microbiol
57: 795-802
[Abstract][Full Text]
Koubaa Mahjoub, W., Chaumette-Planckaert, M.-T., Penas, E. M. M., Dierlamm, J., Leroy, K., Delfau, M.-H., Loriau, J., Gaulard, P., Delchier, J.-C., Zafrani, E.-S., Copie-Bergman, C.
(2008). Primary Hepatic Lymphoma of Mucosa-Associated Lymphoid Tissue Type: A Case Report With Cytogenetic Study. INT J SURG PATHOL
16: 301-307
[Abstract]
Schollkopf, C., Melbye, M., Munksgaard, L., Smedby, K. E., Rostgaard, K., Glimelius, B., Chang, E. T., Roos, G., Hansen, M., Adami, H.-O., Hjalgrim, H.
(2008). Borrelia infection and risk of non-Hodgkin lymphoma. Blood
111: 5524-5529
[Abstract][Full Text]
Munshi, N. C., Digumarthy, S., Rahemtullah, A.
(2008). Case 13-2008 -- A 46-Year-Old Man with Rheumatoid Arthritis and Lymphadenopathy. NEJM
358: 1838-1848
[Full Text]
Ekstrom Smedby, K., Vajdic, C. M., Falster, M., Engels, E. A., Martinez-Maza, O., Turner, J., Hjalgrim, H., Vineis, P., Seniori Costantini, A., Bracci, P. M., Holly, E. A., Willett, E., Spinelli, J. J., La Vecchia, C., Zheng, T., Becker, N., De Sanjose, S., Chiu, B. C.-H., Dal Maso, L., Cocco, P., Maynadie, M., Foretova, L., Staines, A., Brennan, P., Davis, S., Severson, R., Cerhan, J. R., Breen, E. C., Birmann, B., Grulich, A. E., Cozen, W.
(2008). Autoimmune disorders and risk of non-Hodgkin lymphoma subtypes: a pooled analysis within the InterLymph Consortium. Blood
111: 4029-4038
[Abstract][Full Text]
Cohen, V. M L, Sweetenham, J., Singh, A. D
(2008). Ocular adnexal lymphoma. What is the evidence for an infectious aetiology?. Br J Ophthalmol
92: 446-448
[Full Text]
Oh, D.-E., Kim, Y.-D.
(2007). Lymphoproliferative Diseases of the Ocular Adnexa in Korea. Arch Ophthalmol
125: 1668-1673
[Abstract][Full Text]
Bacon, C. M, Du, M.-Q., Dogan, A.
(2007). Mucosa-associated lymphoid tissue (MALT) lymphoma: a practical guide for pathologists. J. Clin. Pathol.
60: 361-372
[Abstract][Full Text]
Engels, E. A.
(2007). Infectious Agents as Causes of Non-Hodgkin Lymphoma. Cancer Epidemiol. Biomarkers Prev.
16: 401-404
[Abstract][Full Text]
Arcaini, L, Burcheri, S, Rossi, A, Paulli, M, Bruno, R, Passamonti, F, Brusamolino, E, Molteni, A, Pulsoni, A, Cox, M., Orsucci, L, Fabbri, A, Frezzato, M, Voso, M., Zaja, F, Montanari, F, Merli, M, Pascutto, C, Morra, E, Cortelazzo, S, Lazzarino, M
(2007). Prevalence of HCV infection in nongastric marginal zone B-cell lymphoma of MALT. Ann Oncol
18: 346-350
[Abstract][Full Text]
Chen, M. L., Ge, Z., Fox, J. G., Schauer, D. B.
(2006). Disruption of Tight Junctions and Induction of Proinflammatory Cytokine Responses in Colonic Epithelial Cells by Campylobacter jejuni. Infect. Immun.
74: 6581-6589
[Abstract][Full Text]
Ramakrishna, B S, Venkataraman, S, Mukhopadhya, A
(2006). Tropical malabsorption. Postgrad. Med. J.
82: 779-787
[Abstract][Full Text]
Smedby, K. E., Baecklund, E., Askling, J.
(2006). Malignant Lymphomas in Autoimmunity and Inflammation: A Review of Risks, Risk Factors, and Lymphoma Characteristics.. Cancer Epidemiol. Biomarkers Prev.
15: 2069-2077
[Abstract][Full Text]
Serra, S, Jani, P A
(2006). An approach to duodenal biopsies. J. Clin. Pathol.
59: 1133-1150
[Abstract][Full Text]
Cohen, S. M., Petryk, M., Varma, M., Kozuch, P. S., Ames, E. D., Grossbard, M. L.
(2006). Non-Hodgkin's Lymphoma of Mucosa-Associated Lymphoid Tissue. The Oncologist
11: 1100-1117
[Abstract][Full Text]
Zucca, E., Bertoni, F.
(2006). Chlamydia or not Chlamydia, that is the question: which is the microorganism associated with MALT lymphomas of the ocular adnexa?. JNCI J Natl Cancer Inst
98: 1348-1349
[Full Text]
Raderer, M, Streubel, B, Wohrer, S, Hafner, M, Chott, A
(2006). Successful antibiotic treatment of Helicobacter pylori negative gastric mucosa associated lymphoid tissue lymphomas. Gut
55: 616-618
[Abstract][Full Text]
Suarez, F., Lortholary, O., Hermine, O., Lecuit, M.
(2006). Infection-associated lymphomas derived from marginal zone B cells: a model of antigen-driven lymphoproliferation. Blood
107: 3034-3044
[Abstract][Full Text]
Grunberger, B., Hauff, W., Lukas, J., Wohrer, S., Zielinski, C. C., Streubel, B., Chott, A., Raderer, M.
(2006). 'Blind' antibiotic treatment targeting Chlamydia is not effective in patients with MALT lymphoma of the ocular adnexa. Ann Oncol
17: 484-487
[Abstract][Full Text]
Schottenfeld, D., Beebe-Dimmer, J.
(2006). Chronic inflammation: a common and important factor in the pathogenesis of neoplasia.. CA Cancer J Clin
56: 69-83
[Abstract][Full Text]
Ha, C. S., Medeiros, L. J., Charnsangavej, C., Crump, M., Gospodarowicz, M. K.
(2006). Oncodiagnosis Panel: 2004: Lymphoma. RadioGraphics
26: 607-620
[Full Text]
Rosado, M. F., Byrne, G. E. Jr, Ding, F., Fields, K. A., Ruiz, P., Dubovy, S. R., Walker, G. R., Markoe, A., Lossos, I. S.
(2006). Ocular adnexal lymphoma: a clinicopathologic study of a large cohort of patients with no evidence for an association with Chlamydia psittaci. Blood
107: 467-472
[Abstract][Full Text]
Nambiar, P. R., Kirchain, S. M., Courmier, K., Xu, S., Taylor, N. S., Theve, E. J., Patterson, M. M., Fox, J. G.
(2006). Progressive Proliferative and Dysplastic Typhlocolitis in Aging Syrian Hamsters Naturally Infected with Helicobacter spp.: A Spontaneous Model of Inflammatory Bowel Disease. Vet Pathol
43: 2-14
[Abstract][Full Text]
Rivoal, K., Ragimbeau, C., Salvat, G., Colin, P., Ermel, G.
(2005). Genomic Diversity of Campylobacter coli and Campylobacter jejuni Isolates Recovered from Free-Range Broiler Farms and Comparison with Isolates of Various Origins. Appl. Environ. Microbiol.
71: 6216-6227
[Abstract][Full Text]
Schmidt-Ott, R., Brass, F., Scholz, C., Werner, C., Gross, U.
(2005). Improved serodiagnosis of Campylobacter jejuni infections using recombinant antigens. J Med Microbiol
54: 761-767
[Abstract][Full Text]
Ferreri, A. J.M., Ponzoni, M., Guidoboni, M., De Conciliis, C., Resti, A. G., Mazzi, B., Lettini, A. A., Demeter, J., Dell'Oro, S., Doglioni, C., Villa, E., Boiocchi, M., Dolcetti, R.
(2005). Regression of Ocular Adnexal Lymphoma After Chlamydia Psittaci-Eradicating Antibiotic Therapy. JCO
23: 5067-5073
[Abstract][Full Text]
Ge, Z., Feng, Y., Whary, M. T., Nambiar, P. R., Xu, S., Ng, V., Taylor, N. S., Fox, J. G.
(2005). Cytolethal Distending Toxin Is Essential for Helicobacter hepaticus Colonization in Outbred Swiss Webster Mice. Infect. Immun.
73: 3559-3567
[Abstract][Full Text]
Bende, R. J., Aarts, W. M., Riedl, R. G., de Jong, D., Pals, S. T., van Noesel, C. J.M.
(2005). Among B cell non-Hodgkin's lymphomas, MALT lymphomas express a unique antibody repertoire with frequent rheumatoid factor reactivity. JEM
201: 1229-1241
[Abstract][Full Text]
Ho, L., Davis, R. E., Conne, B., Chappuis, R., Berczy, M., Mhawech, P., Staudt, L. M., Schwaller, J.
(2005). MALT1 and the API2-MALT1 fusion act between CD40 and IKK and confer NF-{kappa}B-dependent proliferative advantage and resistance against FAS-induced cell death in B cells. Blood
105: 2891-2899
[Abstract][Full Text]
Al-Saleem, T., Al-Mondhiry, H.
(2005). Immunoproliferative small intestinal disease (IPSID): a model for mature B-cell neoplasms. Blood
105: 2274-2280
[Abstract][Full Text]
Thieblemont, C.
(2005). Clinical Presentation and Management of Marginal Zone Lymphomas. ASH Education Book
2005: 307-313
[Abstract][Full Text]
Jaffe, E. S.
(2004). Common Threads of Mucosa-Associated Lymphoid Tissue Lymphoma Pathogenesis: From Infection to Translocation. JNCI J Natl Cancer Inst
96: 571-573
[Full Text]
Peterson, M. C., Lecuit, M., Suarez, F., Lortholary, O.
(2004). Immunoproliferative Small Intestinal Disease Associated with Campylobacter jejuni. NEJM
350: 1685-1686
[Full Text]