A 27-year-old man with the autoimmune lymphoproliferative syndrome and a large-B-cell lymphoma had heterozygous mutations in the Fas and perforin (Prf1) genes. The Fas mutation was inherited from his healthy father and was also carried by his healthy brother, whereas the Prf1 mutation was inherited from his healthy mother. The combined effect of the two mutant genes may have contributed to the development of the autoimmune lymphoproliferative syndrome and lymphoma in this patient.
/
T-cell receptors in the blood.1,2,3,4,5,6 In some patients, solid or hematologic cancers,5,6 including Hodgkin's and non-Hodgkin's lymphomas, also develop.7 The genetic defect responsible for this syndrome is in most cases a mutation in the Fas gene.1,2 Fas (also called Apo-1 and CD95), a member of the superfamily of tumor necrosis factor and nerve growth factor receptors, induces apoptosis of lymphocytes when triggered by its ligand (FasL).8 The interaction between Fas and FasL causes trimerization of Fas and the formation of the death-inducing signaling complex, which initiates a cascade of caspases that culminates in the apoptotic death of the cell.9 The Fas–FasL system maintains lymphocyte homeostasis8,9: loss-of-function mutations in the Fas (TNFRSF6) or FasL gene results in the accumulation of lymphocytes, as seen in mice with lpr and gld mutations10 and in patients with ALPS.1,6 Most patients with ALPS have mutations in Fas and are classified as having ALPS type Ia6; others have mutations in FasL (ALPS type Ib) or caspase 10 (ALPS type II).6,11,12 Autosomal recessive inheritance has been described in a minority of patients with ALPS in whom both Fas alleles are mutated. The form of inheritance of ALPS associated with a heterozygous Fas mutation is less clear, since some heterozygous carriers are asymptomatic.6 This variability in the patterns of inheritance may be due to mutations in other genes.
The mechanism of lymphomagenesis in patients with ALPS is also unclear. Defective Fas-mediated apoptosis may impair the body's ability to protect against B-cell cancers,7 but faulty immune surveillance may also be responsible.13 In this regard, the integrity of the perforin–granzyme pathway of cell-mediated killing appears to be critical.14 Perforin, a pore-forming molecule in granules of cytotoxic lymphocytes, is indispensable in the granule–exocytosis pathway of killing, and is thought to have a role in protection against viral infections and tumors that is mediated by T cells and natural killer cells.14 Indeed, an increased incidence of lymphomas has been associated with perforin deficiency in mice.15 We describe a patient with ALPS and mutations in Fas and the perforin gene (Prf1) in whom a non-Hodgkin's lymphoma developed.
Case Report
A 27-year-old man presented with bulky cervical lymphadenopathy. Splenomegaly had been identified when he was three years old. Four years later, intestinal obstruction due to mesenteric lymphadenopathy and severe thrombocytopenia requiring splenectomy developed. At the age of 18 years, he received a diagnosis of chronic hepatitis C infection, but viremia persisted despite treatment with interferon alfa. At the age of 25 years, he underwent a biopsy of a cervical lymph node because of adenopathy, which disclosed reactive follicular hyperplasia; a bone marrow biopsy did not reveal lymphoma. ALPS was diagnosed, and the patient underwent excision of cervical lymph nodes. Two years later, cervical lymphadenopathy recurred, with fever, weight loss, and itching; a lymph-node biopsy was diagnostic of a T-cell–rich, histiocyte-rich, diffuse large-B-cell lymphoma, according to the World Health Organization classification. Staging demonstrated multiple sites of involvement, including the liver and bone marrow. After two cycles of doxorubicin, prednisone, and vincristine and two cycles of dexamethasone, cytarabine, and cisplatin, worsening liver function precluded further chemotherapy. Shortly thereafter, the patient died of progressive lymphoma.
Methods
Flow Cytometry
Lymphocyte subpopulations in peripheral-blood mononuclear cells were analyzed by means of flow cytometry. Fas-mediated apoptosis of phytohemagglutinin A–activated lymphoblasts, which were cultured for 18 days, was evaluated by means of cytofluorimetric determination of the binding of fluorescein isothiocyanate–labeled annexin V (Bender MedSystem) after treatment of the cells with the IgM anti-Fas monoclonal antibody CH-11 (MBL). The perforin content of peripheral-blood mononuclear cells was determined in fixed and permeabilized cells (Cytofix-Cytoperm, BD PharMingen) with the use of a phycoerythrin-conjugated antibody against perforin (BD PharMingen).
Sequencing of the Fas Gene
Peripheral-blood mononuclear cells were obtained from the patient and his first-degree relatives after they had provided written informed consent. Genomic DNA and total RNA were extracted according to standard methods. The Fas gene (exons and intron boundaries) was sequenced with the use of genomic DNA as a substrate for amplification by means of the polymerase chain reaction (PCR). As described previously,16 reverse-transcriptase (RT) PCR was performed from total RNA with the use of primers mapping within exon 5 (5'AAGGAATGCACACTCACCAG3') and exon 9 (5'CAATGTGTCATACGCTTCT3') as forward and reverse primers, respectively. PCR products were subjected to agarose-gel electrophoresis, excised from the gel, and sequenced.
Sequencing of the Perforin Gene
Genomic DNA was isolated from peripheral-blood mononuclear cells, and exons 2 and 3 of the coding region of the Prf1 gene were amplified with the use of standard PCR conditions. The primers used for amplification have been described previously.17 PCR products were purified with the use of Microcon PCR filter units (Millipore) and then sequenced in an automatic sequencer (ABI 3730XL, Applied Biosystems).
Cytotoxicity Assays
The natural killer activity of peripheral-blood mononuclear cells was assessed by means of standard chromium-51–release assays with the use of the K562 cell line, which is sensitive to natural killer cells, as a target. Results are expressed as the percentage of cell-specific lysis. Anti-CD3–dependent cytotoxic activity was measured against Fas-deficient L1210-3 target cells (kindly provided by P. Golstein, Marseille, France), according to a previously described method.17
Results and Discussion
Our patient with ALPS and a non-Hodgkin's lymphoma carried heterozygous mutations of Fas and Prf1, both of which are located on chromosome 10.1,17 The Fas mutation, inherited from his healthy father, was also found in a healthy brother, whereas the Prf1 mutation was detected in his healthy mother (Figure 1).
|
/+ T cells in the blood (32 percent of all CD3+ T cells, as compared with less than 2 percent in normal donors), and defective in vitro Fas-mediated apoptosis (3 percent of cells were positive for annexin V, as compared with 33 percent in one healthy subject). The patient's Fas gene had a novel point mutation in intron 7 (the substitution of A for G), affecting a canonical splicing site (IVS7 at nucleotide 1) (Figure 1 and Figure 2). This mutation causes the skipping of exon 7 and a frame shift in exon 8. The frame shift reveals a stop codon in exon 8. Abnormally spliced products lacking exon 7 were identified by analysis of complementary DNA (cDNA) (Figure 2). The predicted protein would lack the death domain of Fas, which is required for the induction of apoptosis.9 Our patient was therefore classified as having ALPS type Ia. The same Fas mutation was found in his father and brother, who had no evidence of ALPS and were healthy. However, their lymphocytes had impaired Fas-mediated apoptosis in vitro (data not shown), as has been reported in other mutation-positive healthy relatives of patients with ALPS.3
|
The particularly aggressive course of the lymphoma in our patient prompted us to look for mutations in other genes besides Fas. Among the candidates we investigated was the Prf1 gene. In our patient, the Prf1 gene had a point mutation in exon 3 (755A
G), causing a change from asparagine to serine at position 252 (N252S). This mutation occurs within the membrane-attack complex, a region critically involved in the pore-forming activity of the molecule.21 The same mutation was found in our patient's healthy mother (Figure 1). Biallelic Prf1 mutations have been found in about 40 percent of cases of familial hemophagocytic lymphohistiocytosis,17,22,23,24 a rare, life-threatening immune deficiency affecting infants and young adults. A patient with this disorder and the same heterozygous Prf1 mutation as that in our patient has been described.17 This mutation was not found in 25 Italian patients with familial hemophagocytic lymphohistiocytosis or in 50 healthy Italian control subjects (data not shown).
Peripheral-blood mononuclear cells from the above-mentioned patient with familial hemophagocytic lymphohistiocytosis and a heterozygous Prf1 mutation17 had reduced cytotoxic activity and grossly deficient perforin levels, suggesting a second, as yet undetermined, mutation affecting perforin expression.17 By contrast, peripheral-blood mononuclear cells from our patient and his mother had normal intracellular levels of perforin (data not shown), and the levels of activity of natural killer cells and cytotoxic T cells were similar to those in healthy controls (Figure 3). These results were not surprising, given the reported lack of a dominant negative effect of this particular Prf1 mutation17; moreover, the wide range of in vitro cytotoxic activity of normal natural killer cells and cytotoxic T cells makes a partial deficiency — as would be expected in persons who were heterozygous for a Prf1 mutation — difficult to identify.
|
In conclusion, we propose that ALPS and lymphoma developed in our patient owing to a combined effect of mutations in Fas and Prf1. A perforin mutation may be one of the additional defects contributing to the development of lymphoma in patients with ALPS, possibly in conjunction with other, unknown factors. Defective Fas-mediated apoptosis could allow the prolonged survival of lymphocytes, which might then become targets of transforming events, whereas defects in Fas-mediated killing and in the granule–exocytosis pathway would impair immune surveillance for transformed cells. This proposal is consistent with evidence that immune surveillance prevents the development of lymphomas from clonal B cells in aging mice with lpr and gld mutations.13
Supported in part by grants from the Histiocyte Society and the Istituto di Ricovero e Cura a Carattere Scientifico San Matteo (to Dr. Danesino), the Ministero dell'Università e Ricerca Scientifica e Tecnologica (to Dr. Sabbadini), and Telethon (E1170, to Dr. Umberto Dianzani).
We are indebted to Sara Deola and M.G. Roncarolo for helpful discussions, to P. Golstein for providing the L1210-3 cell line, and to S. Trifari and A. Moretta for technical support.
Source Information
From the Department of Biology and Medical Genetics, University of Pavia, Pavia (R.C., C.D.); the Department of Pediatric Hematology–Oncology (R.C., A. Cometa, R.M., F.L.), Istituto di Ricovero e Cura a Carattere Scientifico Policlinico San Matteo, Pavia; the Department of Oncology–Laboratory of Tumor Immunology (L. Dagna, M.F.), the Unit of Hematology–Bone Marrow Transplantation (F.C., M.B.), the Department of Pathology (M.P.), the Clinical Immunology and Rheumatology Unit (M.G.S.), and the Telethon Institute for Gene Therapy (L. Dupré), Istituto di Ricovero e Cura a Carattere Scientifico Ospedale San Raffaele, Milan; Vita-Salute San Raffaele University School of Medicine, Milan (L. Dagna, M.G.S., C.R.); and the Interdisciplinary Research Center of Autoimmune Diseases and Department of Medical Sciences, A. Avogadro University of Eastern Piedmont, Novara (U.D., I.D., A. Chiocchetti) — all in Italy.
Drs. Ferrarini and Bregni contributed equally to this article.
Address reprint requests to Dr. Bregni at the Unit of Hematology–Bone Marrow Transplantation, Istituto Scientifico H. San Raffaele, 20132 Milan, Italy, or at marco.bregni{at}hsr.it.
References
| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Related Letters:
Autoimmune Lymphoproliferative Syndrome and Perforin
Rieux-Laucat F., Le Deist F., De Saint Basile G., Clementi R., Ferrarini M., Bregni M.
Extract |
Full Text |
PDF
N Engl J Med 2005;
352:306-307, Jan 20, 2005.
Correspondence
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |
Previous
