|
and the Glucocorticoid Receptor in Asthmatic Bronchial Smooth-Muscle Cells
Background Increased proliferation of bronchial smooth-muscle cells may lead to increased muscle mass in the airways of patients with asthma. The antiproliferative effect of glucocorticoids in bronchial smooth-muscle cells in subjects without asthma is mediated by a complex of the glucocorticoid receptor and the CCAAT/enhancer binding protein
Methods Lines of bronchial smooth-muscle cells were established from cells from 20 subjects with asthma, 8 subjects with emphysema, and 26 control subjects. Cell proliferation was determined by means of cell counts and [3H]thymidine incorporation. Signal transduction was studied by means of an electrophoretic DNA mobility-shift assay, a supershift electrophoretic-mobility assay, immunoblotting, use of C/EBP
Results Glucocorticoids activated the glucocorticoid receptor and inhibited serum-induced secretion of interleukin-6 in bronchial smooth-muscle cells from both subjects with asthma and those without asthma; however, glucocorticoids inhibited proliferation only in bronchial smooth-muscle cells from subjects without asthma. C/EBP
Conclusions We hypothesize that a cell-typespecific absence of C/EBP
(C/EBP
). We examined the signaling pathway controlling the inhibitory effect of glucocorticoids on cell proliferation and interleukin-6 synthesis in bronchial smooth-muscle cells of subjects with asthma and those without asthma.
antisense oligonucleotides, and use of a human C/EBP
expression vector. Interleukin-6 release was determined by means of an enzyme-linked immunosorbent assay.
protein was detected by immunoblotting in all bronchial smooth-muscle cells from subjects without asthma but not in those with asthma, whereas the protein was expressed in lymphocytes from both groups of subjects. C/EBP
antisense oligonucleotides or the glucocorticoid-receptor inhibitor mifepristone reversed the antiproliferative effect of glucocorticoids in bronchial smooth-muscle cells from subjects without asthma. When bronchial smooth-muscle cells from subjects with asthma were transiently transfected with an expression vector for human C/EBP
, two forms of the protein were expressed, and subsequent administration of glucocorticoids inhibited cell proliferation.
is responsible for the enhanced proliferation of bronchial smooth-muscle cells derived from subjects with asthma and that it explains the failure of glucocorticoids to inhibit proliferation in vitro.
Glucocorticoids down-regulate the secretion of several inflammatory cytokines by various types of cells resident in the human lung,6,7,8,9 and this process is thought to be mediated by the ligand-activated glucocorticoid receptor.9,10,11 On activation, the glucocorticoid receptor migrates to the nucleus, where it binds to its specific DNA consensus sequence, the glucocorticoid-responsive element,9,10,11 or interacts with other transcription factors.10,12,13
CCAAT/enhancer-binding proteins (C/EBPs) are involved in cell proliferation. The activation of C/EBP
and C/EBP
, which are antiproliferative transcription factors, leads to cell differentiation.14,15,16,17 In contrast, C/EBP
and C/EBP
seem to drive cell-cycle progression.16,17,18,19 C/EBP
forms complexes with C/EBP
and C/EBP
, thereby modulating their function.17 C/EBP
is a relatively recently identified isoform with various synonyms (e.g., Ig/EBP and Gadd153) and may play a specific role in the function of the endoplasmic reticulum.17,20
Glucocorticoids down-regulate the proliferation of airway smooth-muscle cells21 by decreasing the expression of cyclin D1 and the phosphorylation of retinoblastoma protein22 and by activating p21(Waf1/Cip1).23 In human-lung fibroblasts and pulmonary vascular and bronchial smooth-muscle cells from patients without asthma, glucocorticoid treatment rapidly induces the activation of glucocorticoid receptors and C/EBP
, and subsequently the expression of the p21(Waf1/Cip1) gene is faster than predicted on the basis of animal models.23,24,25,26,27,28 Furthermore, transcriptional activation of the p21(Waf1/Cip1) gene by glucocorticoids does not require the glucocorticoid-receptormediated synthesis of C/EBP
in lung fibroblasts, pulmonary vascular smooth-muscle cells, or bronchial smooth-muscle cells.25,26 Because of the importance of glucocorticoid treatment in asthma, we investigated whether the pathways outlined above are operative in bronchial smooth-muscle cells obtained from subjects with asthma. Furthermore, we assessed whether the modulation of cytokine release by glucocorticoids involves the same signaling cascade in bronchial smooth-muscle cells from subjects with asthma as in those from subjects without asthma.
Methods
Cell Culture
Primary cultures of bronchial smooth-muscle cells were established from airway-muscle bundles obtained from 26 control subjects (14 who were undergoing lung resection for a tumor, 4 who were undergoing transplantation for cystic fibrosis, and 8 who were healthy), 8 subjects with emphysema, and 20 subjects with asthma. Cells were grown as described previously in Dulbecco's minimal essential medium containing 10 percent fetal-calf serum, a 1 percent minimal essential mediumvitamin mix, and 20 mM HEPES.3 The characteristics of the subjects are summarized in Table 1. All experiments were performed between passages 3 and 6. In addition, peripheral-blood lymphocytes were isolated from 10 ml of blood from four subjects with asthma and four controls according to standard procedures with the use of a Ficoll gradient.25
|
Cell Counting and DNA Synthesis
Cells were seeded at a density of 104 cells per square centimeter in 24-well cell-culture plates in growth medium (Dulbecco's minimal essential medium containing 5 percent fetal-calf serum) for 24 hours to allow adherence. The medium was replaced by low-serum medium (Dulbecco's minimal essential medium containing 0.1 percent fetal-calf serum) for one day and then exchanged with growth medium, with or without a single or repeated doses of budesonide, dexamethasone, prednisolone, or hydrocortisone (1012 to 108 M). Cell proliferation was assessed after three and five days of treatment with 5 percent fetal-calf serum; cells were washed twice with ice-cold phosphate-buffered saline and then treated with trypsin and EDTA (1 mM and 0.05 percent, respectively) for one minute. The trypsin solution was removed, and the cells were resuspended in 0.5 ml of phosphate-buffered saline. Cells contained in 0.01 ml of phosphate-buffered saline were counted in duplicate for each well with the use of a Neubauer improved hemocytometer.3,25
The incorporation of [3H]thymidine was measured according to standard protocols. Cells were prepared as they were for cell counts but were cultured for 24 hours only after stimulation and the addition of 5 µCi of [3H]thymidine per milliliter during the last 6 hours of culture. Thymidine incorporation was determined by liquid scintillation, with counting performed in triplicate.25,26,28
Treatment
Mifepristone (107 or 106 M) was used to inhibit glucocorticoid-receptordependent cell responses. Sulfonated antisense C/EBP
oligonucleotide (5'G-AAGGCCGCGGCGCTGCTGGGCGCGT3', MWG Biotech) was used to down-regulate C/EBP
protein,17,18,25 and a scrambled sulfonated oligonucleotide (5'AGCTCGGATGCATGGAGGAG3', MWG Biotech) was used as a negative control.
C/EBP
Expression Vector
The C/EBP
expression vector was constructed from the total RNA of human peripheral-blood lymphocytes with the use of RNeasy (Qiagen). One microgram of total RNA was reverse-transcribed by means of SuperScript II (Invitrogen), and the entire coding sequence of C/EBP
was amplified with Pfx polymerase enzyme (Invitrogen) by means of the polymerase chain reaction (PCR) under the following conditions: primary denaturation at 98°C for 2 minutes was followed by 55 cycles of denaturation at 98°C for 30 seconds, annealing at 61°C for 30 seconds, elongation at 68°C for 100 seconds, and elongation at 68°C for 7 minutes. The C/EBP
primers were 5'CACCATGGAGTCGGCCGACTTCT3' and 3'TCACGCGCAGTTGCCCATG5'. After electrophoresis on a 5 percent agarose gel, the C/EBP
DNA band was isolated with the use of NucleoSpin extract (Macherey-Nagel) and was cloned into a pvDNA3.1D/V5-His6TOPO vector (Invitrogen) by mixing 4 µl of CEBP
DNA extract with 1 µl of salt solution (1.2 M sodium chloride and 0.06 M magnesium chloride) and 1 µl of the TOPO vector. The mixture was incubated for five minutes at room temperature, and 2 µl of C/EBP
vector was transfected into Escherichia coli. The success of transfection was confirmed on the basis of the response to ampicillin. Transfected cells were assessed for C/EBP
DNA, which was sequenced with the use of an automated sequencer (MWG Biotech).
Cells were transiently transfected with the C/EBP
expression vector or a green fluorescent protein vector for one hour in serum-free medium containing 1.0 ng of either vector per microliter in Tfx50 reagent (Promega) (ratio of Tfx50 to DNA, 3:1). Transfected cells were then incubated in growth medium for 24 hours in the presence or absence of drugs. The transfection rate was measured in transiently transfected bronchial smooth-muscle cells with the use of a green fluorescent protein vector that is, a cytomegalovirus-epidermal growth factor promoterdriven vector (p-d2EGFP-N1, Clontech). Transfection was carried out with the use of 1 µg of DNA per milliliter and Tfx50 (ratio, 1:2 to 1:4) for one hour in serum-free medium. Five percent fetal-calf serum was then added to the medium for 24 hours before confocal microscopy of the living cells was performed (model LSM 510, Zeiss). The laser excitation wavelength was 488 nm; fluorescence was detected between 505 and 550 nm with the use of a pinhole aperture of 106 µm. Autofluorescence was not detected between 560 and 615 nm with the use of a wavelength of 543 nm.
Nuclear and Cytosolic Extracts and Electrophoretic Mobility-Shift Assay
Nuclear and cytosolic extracts were prepared from cultures that were 80 percent confluent, as described previously.25 Bronchial smooth-muscle cells were scraped off 175-cm2 flasks and centrifuged at 5000xg for 2 minutes at 4°C, and the pellet was resuspended in 80 µl of low-salt buffer (20 mM HEPES [pH 7.9], 10 mM potassium chloride, 0.1 mM sodium vanadate, 1 mM EDTA, 1 mM EGTA, 0.2 percent NP-40, 10 percent glycerol, and complete protease inhibitor [Roche Diagnostics]) and incubated for 10 minutes at 4°C. After centrifugation at 13,000xg for one minute at 4°C, the supernatant (the cytosolic fraction) was collected. The remaining pellet was dissolved in 50 µl of high-salt buffer (420 mM sodium chloride, 20 mM HEPES at pH 7.9, 10 mM potassium chloride, 0.1 mM sodium vanadate, 1 mM EDTA, 1 mM EGTA, 20 percent glycerol, and complete protease inhibitor), kept on ice for 30 minutes, and centrifuged at 13,000xg for 5 minutes at 4°C. The supernatant collected was considered the nuclear fraction.25,26,28 The protein level was determined with the use of the Bradford assay.
Immunoblotting
Proteins were fractionated according to size, as follows: 5 µg of total protein was applied to a polyacrylamidesodium dodecyl sulfate gel with a gradient of 4 to 15 percent and transferred to polyvinyledine fluoride membranes (Millipore) according to standard protocols; transfer was confirmed by Ponceau's staining.17,25 Membranes were blocked by the addition of 5 percent skim milk in 10 mM TRIS, 150 mM sodium chloride, and 0.05 percent Tween 20 for 1 hour; incubated for 12 hours at 4°C with a primary monoclonal antibody specific for the glucocorticoid receptor (sc-100X), C/EBP
(sc-61X), or c-Fos/activator protein-1 (AP-1) (sc-253X) (all Santa Cruz Biotechnology); washed three times in blocking solution; and then incubated with a secondary antirabbit antibody conjugated with horseradish peroxidase (sc-2054, Santa Cruz Biotechnology) for 1 hour. Membranes were washed three times with blocking buffer and once with phosphate-buffered saline, and protein bands were visualized by means of chemiluminescence (ECL, Pierce).
DNA-binding proteins were characterized by means of an electrophoretic mobility-shift assay with the use of a 32P-labeled glucocorticoid-responsive element or CCAAT-binding oligonucleotide (sc-2545 and sc-2525, respectively; Santa Cruz Biotechnology) as described previously.25 We also used a 32P-labeled p21(Waf1/Cip1) promoter fragment containing the C/EBP-binding sites (a gift from Dr. B. Vogelstein, Johns Hopkins University, Baltimore),29 which has been used by others to characterize the glucocorticoid receptorC/EBP
DNA consensus sequence of the p21(Waf1/Cip1) promoter,23,24,27 and which we have previously used to show the formation of the glucocorticoid receptorC/EBP
complex.25 Supershift assays (defined by a mobility shift of the p21 promoter fragment) were performed by incubating nuclear extracts with one of the above antibodies (1 mg per milliliter) specific for the glucocorticoid receptor, C/EBP
, or the transcription factor AP-1 overnight at 4°C; DNAprotein complexes and supershifts were analyzed on a nondenaturing 4 percent polyacrylamide gel exposed to x-ray films. The specificity of the observed DNAprotein complexes was characterized by preincubating the extracts with 10 times the normal amount of competitive, unlabeled glucocorticoid-responsive element or CCAAT oligonucleotides.25,26,28
Coimmunoprecipitation of the Glucocorticoid Receptor or C/EBP-
Coimmunoprecipitations were performed as described previously.25 Extracts of nuclear protein (20 µl) were incubated overnight at 4°C with antibody against C/EBP
(1 µg per milliliter) or against glucocorticoid receptor (1 µg per milliliter, Santa Cruz) and then incubated for one hour with protein A Sepharose (1 mg per milliliter) in phosphate-buffered saline at 37°C. After centrifugation at 5000xg for five minutes, the precipitate was washed twice with 2 ml of phosphate-buffered saline and then resuspended in Laemmli buffer and analyzed by means of immunoblotting.25
Interleukin-6 Enzyme-Linked Immunosorbent Assay
Cell-culture medium was collected 0, 6, 12, and 24 hours after stimulation of cells with 5 percent fetal-calf serum in the presence or absence of drugs or antisense oligonucleotides. The release of interleukin-6 was detected by means of an enzyme-linked immunosorbent assay (Quantikine, R&D Systems).
Statistical Analysis
Analysis of variance and an unpaired Student's t-test were used to assess the data for cell counts and [3H]thymidine incorporation. Results were considered significant if the two-sided P value was less than 0.05.
Results
The clinical characteristics of all 54 study subjects from whom we obtained cells for bronchial smooth-muscle cell cultures are shown in Table 1. There were 35 males and 19 females. Owing to the wide range of ages among subjects with asthma, the mean age of this group did not differ significantly from that of the other two groups (Table 1).
Figure 1A shows a representative time course of budesonide-induced (108 M) translocation of glucocorticoid receptor from the cytosol to the nucleus in bronchial smooth-muscle cell lines from subjects with asthma and those with emphysema. Budesonide activated the glucocorticoid receptor within 30 minutes, with levels peaking at 1 hour and declining thereafter. Similar time courses were observed for dexamethasone, prednisolone, and hydrocortisone at concentrations ranging from 109 to 106 M. As summarized in Figure 1B, the time course of the activation of the glucocorticoid receptor by budesonide was similar among bronchial smooth-muscle cell lines from 10 controls, 8 subjects with emphysema, and 12 subjects with asthma, and the time course of the accumulation of glucocorticoid receptors in the nucleus was similar for all four glucocorticoids, with no significant differences in efficacy (data not shown). A second, minor band appeared soon after glucocorticoid treatment (Figure 1A). This band may represent the
isoform of the glucocorticoid receptor but represents only a small proportion of the total.
|
To determine the antiinflammatory effect of glucocorticoids, we analyzed the cell-culture medium of the above experiments for the presence of interleukin-6. After adjustment for the cell numbers, the level of secretion of interleukin-6 induced by the addition of 5 percent fetal-calf serum after 24 and 48 hours was similar between bronchial smooth-muscle cells from 10 subjects with asthma and bronchial smooth-muscle cells from 10 subjects without asthma (Figure 2A). All glucocorticoids significantly inhibited the serum-induced secretion of interleukin-6 (P<0.001).
|
antisense or sense oligonucleotide. The addition of 1.0 µM C/EBP
antisense oligonucleotide resulted within 24 hours in the down-regulation of serum-induced C/EBP
protein expression in total cell-protein extracts in bronchial smooth-muscle cells from subjects without asthma (Figure 2B).
When cells were pretreated for one hour with 107 M mifepristone, the inhibitory effect of the glucocorticoids on the secretion of interleukin-6 was substantially reduced (Figure 2C). However, preincubation for 24 hours with 1 µM C/EBP
antisense oligonucleotides did not significantly alter the inhibitory effect of the glucocorticoids on the serum-induced secretion of interleukin-6.
Previously, we reported that a single dose of 108 M budesonide led to a mean (±SE) maximal decrease of 21±4 percent in the serum-induced proliferation of bronchial smooth-muscle cells from subjects without asthma.26 In the present study, we observed a similar inhibition of fetal-calf serumstimulated cell proliferation after three days of culture in the presence of any one of the four glucocorticoids studied after a single treatment on day 1 (Figure 3A). In bronchial smooth-muscle cells from 10 subjects, 108 M budesonide reduced the serum-dependent proliferation of cells by 28±4 percent (P<0.01 by an unpaired Student's t-test), 108 M dexamethasone reduced proliferation by 21±4 percent (P<0.01), and 108 M prednisolone reduced proliferation by 24±3 percent (P<0.01), whereas 108 M hydrocortisone did not inhibit proliferation significantly (Figure 3A). A comparison of Figure 3A and Figure 3B shows that bronchial smooth-muscle cells from 15 subjects with asthma grew about 1.5 times as fast as bronchial smooth-muscle cells from subjects without asthma, a finding that is similar to our previous findings.3 Surprisingly, none of the glucocorticoids inhibited the proliferation of bronchial smooth-muscle cells from subjects with asthma (Figure 3B).
|
Given our previous results,25,26 we assessed the role of C/EBP
in glucocorticoid-inhibited proliferation of bronchial smooth-muscle cells. As shown in a set of representative immunoblots (Figure 4A), bronchial smooth-muscle cells from 20 subjects with asthma did not express C/EBP
, whereas serum-starved bronchial smooth-muscle cells from 8 subjects with emphysema and 15 controls expressed the 46-kD C/EBP
protein. The expression of C/EBP
could be induced by 5 percent fetal-calf serum within 24 hours in all bronchial smooth-muscle cells from subjects without asthma (Figure 2B and Figure 4A). However, bronchial smooth-muscle cells from 4 of the 20 subjects with asthma expressed a smaller protein that reacted with the antibody against C/EBP
antibody (Figure 4A). However, to visualize these smaller protein bands, we had to double the duration of exposure of the immunoblots.
|
is a pathophysiological characteristic present in cell types other than bronchial smooth-muscle cells, we isolated peripheral-blood lymphocytes from four subjects with asthma and four without asthma. We detected C/EBP
protein in all the samples (Figure 4B).
To overcome the absence of C/EBP
in bronchial smooth-muscle cells from subjects with asthma, we transiently transfected three such cell lines with an expression vector for the human C/EBP
isolated from bronchial smooth-muscle cells from subjects without asthma. Immunoblotting revealed a time-dependent increase in the expression of C/EBP
within 24 and 48 hours after transfection (Figure 4C). The smooth-muscle cells expressed two proteins that reacted with the antibody against C/EBP
(Figure 4C). According to the molecular-weight markers, the upper band appeared at the expected size for C/EBP
, whereas the smaller band was similar to the second C/EBP
band that was observed in nontransfected bronchial smooth-muscle cells from subjects with asthma (Figure 4A and Figure 4C). The rate of transfection was controlled with the use of a cytomegalovirus epidermal growth factor promoterdriven vector; the level of expression of epidermal growth factor by bronchial smooth-muscle cells was 62 percent 24 hours after transfection (Figure 4D).
The absence of C/EBP
in bronchial smooth-muscle cells from subjects with asthma was confirmed with the use of a supershift electrophoretic mobility-shift assay with a p21(Waf1/Cip1) promoter fragment containing the glucocorticoid receptorC/EBP
complex binding site23,24,25,27,29 as the target for C/EBP
proteins, in the presence and absence of antibodies specific for C/EBP
or the glucocorticoid receptor; antibodies against c-Fos/AP-1 protein served as a negative control. As shown in Figure 4E, incubation of the p21(Waf1/Cip1) promoter fragment with nuclear-protein extracts that were obtained from bronchial smooth-muscle cells from subjects without asthma in the presence of 108 M budesonide for three hours resulted in a defined signal that could be abrogated by incubation with 10 times the normal amount of cold CCAAT oligonucleotide overnight at 4°C. When the complex formed by the p21(Waf1/Cip1) promoter fragment and the nuclear-protein extracts of budesonide-treated bronchial smooth-muscle cells was further incubated with antibodies specific for C/EBP
, the level of the complex increased and its migration was further delayed (Figure 4E, lane 4). A similar supershift was observed when the p21(Waf1/Cip1) promoter fragment formed a complex with the nuclear-protein extract of budesonide-treated bronchial smooth-muscle cells from subjects without asthma and was incubated with antibodies specific for the glucocorticoid receptor (Figure 4E, lane 6), whereas no such supershift was detected when we used antibodies against c-Fos/AP-1 (lane 8). In contrast, the nuclear-protein fraction obtained from budesonide-treated bronchial smooth-muscle cells from subjects with asthma did not produce any clear signal when they were incubated with the p21(Waf1/Cip1) promoter fragment (Figure 4E, lanes 5, 7, and 9).
To further assess the role of C/EBP
in bronchial smooth-muscle cells from subjects with asthma, we transiently transfected subconfluent cultures with an expression vector for human C/EBP
or the empty vector as a control (Figure 5A). The level of the C/EBP
protein in nuclear extracts of bronchial smooth-muscle cells from subjects with asthma increased within 48 hours in the presence of budesonide (Figure 5A, lanes 1 and 2), preincubation with 10 times the normal level of unlabeled CCAAT oligonucleotide diminished the signal (Figure 5A, lane 3), and no signal was observed when the cells were transfected with the empty control vector for 48 hours (Figure 5A, lane 4). When the extract was subsequently incubated with antibodies specific for C/EBP
, migration of the DNA-protein band was retarded (Figure 5A, lane 5), whereas there was no signal when the cells were transfected with the empty control vector (Figure 5A, lane 6). We observed no supershifts when the same extracts were incubated in the presence of antibodies against c-Fos/AP-1 (Figure 5A, lane 7), whereas a supershift was observed in the presence of antibodies against glucocorticoid receptor (Figure 5A, lane 8). Bronchial smooth-muscle cells transfected with an empty vector did not show a supershift in the presence of antibodies against the glucocorticoid receptor (Figure 5A, lane 9).
|
expression vector reestablished the formation of the glucocorticoid receptorC/EBP
complex previously noted in bronchial smooth-muscle cells from subjects without asthma,25,26 we performed coimmunoprecipitation experiments with the use of nuclear extracts of bronchial smooth-muscle cells that had been incubated with 108 M budesonide for three hours (Figure 5B). Western blot analysis of the coimmunoprecipitates showed a clear band for C/EBP
when we used an antibody against the glucocorticoid receptor for immunoprecipitation and for the glucocorticoid receptor when an antibody against C/EBP-
was used. In contrast, nontransfected bronchial smooth-muscle cells from subjects with asthma did not show any signal for either C/EBP
or the glucocorticoid receptor. However, when these bronchial smooth-muscle cells were transfected with a human C/EBP
expression vector 48 hours before stimulation with budesonide and nuclear extracts were prepared 3 hours after the addition of the drug and subsequent coimmunoprecipitation, we observed a band for C/EBP
when an antibody against the glucocorticoid receptor was used, as well as a band for the receptor when an antibody against C/EBP
was used (Figure 5B).
We obtained further evidence of the function of the transfected C/EBP
expression vector in bronchial smooth-muscle cells from subjects with asthma by counting cells. The numbers of cells in five such nontransfected cell lines doubled within three days in the presence of 5 percent fetal-calf serum, and daily treatment with budesonide (108 M) did not significantly alter cell growth (Figure 5C). Transient transfection with an expression vector for human C/EBP
significantly slowed the proliferation of smooth-muscle cells in the presence of fetal-calf serum (by 30±4.9 percent, P<0.01 by an unpaired Student's t-test), on the basis of the increase in the numbers of cells from day 1 to day 3 in the presence of 5 percent fetal-calf serum. Transfection with the empty vector did not inhibit proliferation. In contrast, transfected cells treated daily with 108 M budesonide had a further reduction of proliferation, as compared with transfected cells that were not treated with budesonide (Figure 5C). The additional effect of the glucocorticoid on the inhibitory effect of the C/EBP
expression vector was significant (P<0.01) in bronchial smooth-muscle cells from five subjects with asthma and was significantly different (P<0.01) from the effect achieved with the C/EBP
vector alone. The presence of the empty vector together with budesonide did not inhibit the proliferation of bronchial smooth-muscle cells from subjects with asthma.
Discussion
Our data indicate that the proliferation of airway smooth-muscle cells in patients with asthma may result from an absence of C/EBP
. The absence of C/EBP
also explains why the antiproliferative action of glucocorticoids on these cells was absent, while the glucocorticoid-induced suppression of interleukin-6 was not affected. Since peripheral-blood lymphocytes had normal levels of C/EBP
, we propose that the absence of C/EBP-
is cell-typespecific.
Hypertrophy and hyperplasia are characteristic of the bronchial smooth-muscle bundles in asthmatic airways, and this increased layer of bronchial smooth muscle may explain the hyperresponsiveness of asthmatic bronchi.1,2,4 It may also explain the local recruitment of immunocompetent cells into the smooth muscle, leading to chronic inflammation.1,2,4 Glucocorticoids are potent suppressors of this chronic inflammation and are the mainstay of therapy for moderate and severe asthma.5,6,7,8,9,10,11
Impaired expression of the glucocorticoid receptor or a mutation in it has been linked to asthma but has never been proved to play a causative role.30,31,32 The expression of the receptor has been assumed to be faulty in patients with asthma, but no significant differences between patients with asthma and those without asthma have been found in the tissue distribution of the glucocorticoid receptor in lung-biopsy specimens.32 Some data have suggested that the receptor has two isoforms,
and
, resulting from differential splicing of the same messenger RNA.33 Both isoforms bind to the same DNA consensus sequence. Because the consensus sequence has a higher affinity for the
isoform, it has been assumed that this isoform inhibits binding of the
isoform,33 but a link between overexpression of the
isoform and the diagnosis of asthma has not been established.34 In our study, glucocorticoids activated the glucocorticoid receptor in all lines of bronchial smooth-muscle cells, irrespective of the disease state, and we did not observe a stronger signal for the
isoform in bronchial smooth-muscle cells from subjects with asthma than in those without asthma. Furthermore, we did not detect a double band for the receptor in the cytosolic protein fractions, whereas a second protein band that reacted with the antibody against the glucocorticoid receptor became visible only in the nuclear protein fractions early after treatment with a glucocorticoid.
The activation of the glucocorticoid receptor by various glucocorticoids suppressed serum-stimulated secretion of interleukin-6 in all lines of bronchial smooth-muscle cells, and mifepristone reversed this effect. Our data indicate that the inhibition of interleukin-6 secretion by glucocorticoids does not involve C/EBP
in human bronchial smooth-muscle cells. Therefore, distinct signaling pathways mediate the antiproliferative and the interleukin-6blocking effects of glucocorticoids. However, the latter effect may include the interaction of the receptor with other transcription factors, including nuclear factor-
B, AP-1, and signal transducers and activators of transcription (STATs).10,12,13,35,36,37,38
The observed failure of glucocorticoids to inhibit cell proliferation in bronchial smooth-muscle cells from subjects with asthma could not be explained by an absent or defective glucocorticoid receptor. Several studies have shown that the antiproliferative effect of glucocorticoids is mediated by the receptor and C/EBP
,14,23,24,25 and both active transcription factors are required to induce the synthesis of p21(Waf1/Cip1).24,25,27 Moreover, in human cells, including lung fibroblasts, pulmonary and bronchial smooth-muscle cells, and peripheral-blood lymphocytes, the glucocorticoid receptor forms a complex with C/EBP
, which then binds to the CCAAT DNA consensus sequence in the p21(Waf1/Cip1) promoter.25,27,28 We found that this complex was absent in budesonide-treated bronchial smooth-muscle cells from subjects with asthma, but that it could be reestablished by transfecting the cells with a human C/EBP
expression vector. Furthermore, transfected cells had a slower rate of proliferation than nontransfected cells, and their proliferation could be inhibited by glucocorticoids. These findings indicate that the absence of C/EBP
in bronchial smooth-muscle cells from patients with asthma may account for their increased rate of proliferation.3 In addition, direct proteinprotein interaction with the glucocorticoid receptor and other transcription factors has been demonstrated only for members of the STAT family13,37,38 for C/EBP
23,25,27 and C/EBP
.36 Therefore, the receptor may regulate cell proliferation and cell differentiation or apoptosis through its interaction with various members of the C/EBP family. We did not observe any interaction between the glucocorticoid receptor and AP-1, which indicates that this transcription factor is not involved in the p21(Waf1/Cip1) regulating complex consisting of the receptor and C/EBP
.
Moreover, the antiproliferative action of glucocorticoids was preserved in bronchial smooth-muscle cells from eight subjects with emphysema, and C/EBP
was also normally expressed in these cells. These observations suggest a difference in the pathogenesis of asthma and emphysema, even though the latter is sometimes regarded as a subtype of asthma.39,40
In conclusion, we have demonstrated that the antiproliferative and the cytokine-inhibitory effects of glucocorticoids are mediated by different signaling pathways. Both pathways involve the activation of the glucocorticoid receptor, but the pathways subsequently diverge. The antiproliferative pathway does not function in patients with asthma because bronchial smooth-muscle cells in these patients lack C/EBP
protein required to form a complex with the glucocorticoid receptor. The pathological implications of this absence of C/EBP
require evaluation.
Supported by the Medical Foundation of the University of Sydney, Australia; Freiwillige Akademische Gesellschaft, University of Basel, Switzerland; the National Health and Medical Research Council of Australia; GlaxoSmithKline, Loughborough, United Kingdom; and AstraZeneca, Lund, Sweden.
Source Information
From the Department of Pharmacology and the Woolcock Institute of Medical Research, University of Sydney, Sydney, Australia (M.R., P.R.A.J., P.B., G.G.K., Q.G., K.H., J.K.B., J.L.B.); and the Departments of Research and Internal Medicine, Pulmonary Cell Research, University Hospitals Basel, Basel, Switzerland (M.R., M.P.B., J.J.R., M.T.).
Drs. Johnson, Borger, Black, and Tamm contributed equally to this article.
References
2-agonists and corticosteroids on tumour necrosis factor-
-induced interleukin-8 release from cultured human airway smooth-muscle cells. Am J Respir Cell Mol Biol 2000;23:79-85.
(Ig/EBP). J Biol Chem 2002;277:23563-23572.
isoforms in normal versus neoplastic mammary epithelial cells. J Cell Physiol 2001;189:91-105. [Erratum, J Cell Physiol 2002;190:131.] [CrossRef][Web of Science][Medline]
in G(0) growth-arrested mouse mammary epithelial cells. Biochem Biophys Res Commun 1999;262:696-701. [CrossRef][Medline]
transcription factor in the glucocorticoid stimulation of p21(waf1/cip1) gene promoter activity in growth-arrested rat hepatoma cells. J Biol Chem 1998;273:2008-2014.
and the glucocorticoid receptor in vivo and in nontransformed human cells. FASEB J 2002;16:177-184.
2 agonists on bronchial airway smooth muscle cells through synchronised cellular signalling. Lancet 2002;360:1293-1299. [CrossRef][Web of Science][Medline]
2-adrenergic receptor agonists in primary human lung fibroblasts and vascular smooth muscle cells. J Biol Chem 1999;274:1005-1010.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Related Letters:
C/EBP
in Asthma
Levy D. I., Roth M., Borger P., Tamm M.
Extract |
Full Text |
PDF
N Engl J Med 2004;
351:2236-2237, Nov 18, 2004.
Correspondence
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2010 Massachusetts Medical Society. All rights reserved. |