The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 351:560-574 August 5, 2004 Number 6
NextNext

Dysfunctional Interaction of C/EBP{alpha} and the Glucocorticoid Receptor in Asthmatic Bronchial Smooth-Muscle Cells
Michael Roth, Ph.D., Peter R.A. Johnson, Ph.D., Peter Borger, Ph.D., Michel P. Bihl, Ph.D., Jochen J. Rüdiger, M.D., Gregory G. King, M.D., Qi Ge, M.Sc., Katrin Hostettler, M.D., Janette K. Burgess, Ph.D., Judith L. Black, M.B., B.S., Ph.D., and Michael Tamm, M.D.

 

This Article
-Abstract
- PDF
-PDA Full Text
-PowerPoint Slide Set

Commentary
-Perspective
 by Shore, S. A.
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited
-E-mail When Letters Appear

More Information
-PubMed Citation
ABSTRACT

Background Increased proliferation of bronchial smooth-muscle cells may lead to increased muscle mass in the airways of patients with asthma. The antiproliferative effect of glucocorticoids in bronchial smooth-muscle cells in subjects without asthma is mediated by a complex of the glucocorticoid receptor and the CCAAT/enhancer binding protein {alpha} (C/EBP{alpha}). We examined the signaling pathway controlling the inhibitory effect of glucocorticoids on cell proliferation and interleukin-6 synthesis in bronchial smooth-muscle cells of subjects with asthma and those without asthma.

Methods Lines of bronchial smooth-muscle cells were established from cells from 20 subjects with asthma, 8 subjects with emphysema, and 26 control subjects. Cell proliferation was determined by means of cell counts and [3H]thymidine incorporation. Signal transduction was studied by means of an electrophoretic DNA mobility-shift assay, a supershift electrophoretic-mobility assay, immunoblotting, use of C/EBP{alpha} antisense oligonucleotides, and use of a human C/EBP{alpha} expression vector. Interleukin-6 release was determined by means of an enzyme-linked immunosorbent assay.

Results Glucocorticoids activated the glucocorticoid receptor and inhibited serum-induced secretion of interleukin-6 in bronchial smooth-muscle cells from both subjects with asthma and those without asthma; however, glucocorticoids inhibited proliferation only in bronchial smooth-muscle cells from subjects without asthma. C/EBP{alpha} protein was detected by immunoblotting in all bronchial smooth-muscle cells from subjects without asthma but not in those with asthma, whereas the protein was expressed in lymphocytes from both groups of subjects. C/EBP{alpha} antisense oligonucleotides or the glucocorticoid-receptor inhibitor mifepristone reversed the antiproliferative effect of glucocorticoids in bronchial smooth-muscle cells from subjects without asthma. When bronchial smooth-muscle cells from subjects with asthma were transiently transfected with an expression vector for human C/EBP{alpha}, two forms of the protein were expressed, and subsequent administration of glucocorticoids inhibited cell proliferation.

Conclusions We hypothesize that a cell-type–specific absence of C/EBP{alpha} is responsible for the enhanced proliferation of bronchial smooth-muscle cells derived from subjects with asthma and that it explains the failure of glucocorticoids to inhibit proliferation in vitro.


Asthma is characterized pathologically by an increased mass of bronchial smooth muscle,1,2 apparently as a result of the enhanced proliferation of bronchial smooth-muscle cells.3,4 Bronchial smooth-muscle cells are thus considered a major target for antiasthma treatments such as glucocorticoids.5

Glucocorticoids down-regulate the secretion of several inflammatory cytokines by various types of cells resident in the human lung,6,7,8,9 and this process is thought to be mediated by the ligand-activated glucocorticoid receptor.9,10,11 On activation, the glucocorticoid receptor migrates to the nucleus, where it binds to its specific DNA consensus sequence, the glucocorticoid-responsive element,9,10,11 or interacts with other transcription factors.10,12,13

CCAAT/enhancer-binding proteins (C/EBPs) are involved in cell proliferation. The activation of C/EBP{alpha} and C/EBP{epsilon}, which are antiproliferative transcription factors, leads to cell differentiation.14,15,16,17 In contrast, C/EBP{beta} and C/EBP{delta} seem to drive cell-cycle progression.16,17,18,19 C/EBP{gamma} forms complexes with C/EBP{alpha} and C/EBP{beta}, thereby modulating their function.17 C/EBP{zeta} is a relatively recently identified isoform with various synonyms (e.g., Ig/EBP and Gadd153) and may play a specific role in the function of the endoplasmic reticulum.17,20

Glucocorticoids down-regulate the proliferation of airway smooth-muscle cells21 by decreasing the expression of cyclin D1 and the phosphorylation of retinoblastoma protein22 and by activating p21(Waf1/Cip1).23 In human-lung fibroblasts and pulmonary vascular and bronchial smooth-muscle cells from patients without asthma, glucocorticoid treatment rapidly induces the activation of glucocorticoid receptors and C/EBP{alpha}, and subsequently the expression of the p21(Waf1/Cip1) gene is faster than predicted on the basis of animal models.23,24,25,26,27,28 Furthermore, transcriptional activation of the p21(Waf1/Cip1) gene by glucocorticoids does not require the glucocorticoid-receptor–mediated synthesis of C/EBP{alpha} in lung fibroblasts, pulmonary vascular smooth-muscle cells, or bronchial smooth-muscle cells.25,26 Because of the importance of glucocorticoid treatment in asthma, we investigated whether the pathways outlined above are operative in bronchial smooth-muscle cells obtained from subjects with asthma. Furthermore, we assessed whether the modulation of cytokine release by glucocorticoids involves the same signaling cascade in bronchial smooth-muscle cells from subjects with asthma as in those from subjects without asthma.

Methods

Cell Culture

Primary cultures of bronchial smooth-muscle cells were established from airway-muscle bundles obtained from 26 control subjects (14 who were undergoing lung resection for a tumor, 4 who were undergoing transplantation for cystic fibrosis, and 8 who were healthy), 8 subjects with emphysema, and 20 subjects with asthma. Cells were grown as described previously in Dulbecco's minimal essential medium containing 10 percent fetal-calf serum, a 1 percent minimal essential medium–vitamin mix, and 20 mM HEPES.3 The characteristics of the subjects are summarized in Table 1. All experiments were performed between passages 3 and 6. In addition, peripheral-blood lymphocytes were isolated from 10 ml of blood from four subjects with asthma and four controls according to standard procedures with the use of a Ficoll gradient.25

View this table:
[in this window]
[in a new window]
 
Table 1. Characteristics of the 20 Subjects with Asthma, the 8 Subjects with Emphysema, and the 26 Controls.

 
Approval for the experiments was provided by the human ethics committee of the University of Sydney and by the Central Sydney Area Health Service. All patients provided written informed consent.

Cell Counting and DNA Synthesis

Cells were seeded at a density of 104 cells per square centimeter in 24-well cell-culture plates in growth medium (Dulbecco's minimal essential medium containing 5 percent fetal-calf serum) for 24 hours to allow adherence. The medium was replaced by low-serum medium (Dulbecco's minimal essential medium containing 0.1 percent fetal-calf serum) for one day and then exchanged with growth medium, with or without a single or repeated doses of budesonide, dexamethasone, prednisolone, or hydrocortisone (10–12 to 10–8 M). Cell proliferation was assessed after three and five days of treatment with 5 percent fetal-calf serum; cells were washed twice with ice-cold phosphate-buffered saline and then treated with trypsin and EDTA (1 mM and 0.05 percent, respectively) for one minute. The trypsin solution was removed, and the cells were resuspended in 0.5 ml of phosphate-buffered saline. Cells contained in 0.01 ml of phosphate-buffered saline were counted in duplicate for each well with the use of a Neubauer improved hemocytometer.3,25

The incorporation of [3H]thymidine was measured according to standard protocols. Cells were prepared as they were for cell counts but were cultured for 24 hours only after stimulation and the addition of 5 µCi of [3H]thymidine per milliliter during the last 6 hours of culture. Thymidine incorporation was determined by liquid scintillation, with counting performed in triplicate.25,26,28

Treatment

Mifepristone (10–7 or 10–6 M) was used to inhibit glucocorticoid-receptor–dependent cell responses. Sulfonated antisense C/EBP{alpha} oligonucleotide (5'G-AAGGCCGCGGCGCTGCTGGGCGCGT3', MWG Biotech) was used to down-regulate C/EBP{alpha} protein,17,18,25 and a scrambled sulfonated oligonucleotide (5'AGCTCGGATGCATGGAGGAG3', MWG Biotech) was used as a negative control.

C/EBP{alpha} Expression Vector

The C/EBP{alpha} expression vector was constructed from the total RNA of human peripheral-blood lymphocytes with the use of RNeasy (Qiagen). One microgram of total RNA was reverse-transcribed by means of SuperScript II (Invitrogen), and the entire coding sequence of C/EBP{alpha} was amplified with Pfx polymerase enzyme (Invitrogen) by means of the polymerase chain reaction (PCR) under the following conditions: primary denaturation at 98°C for 2 minutes was followed by 55 cycles of denaturation at 98°C for 30 seconds, annealing at 61°C for 30 seconds, elongation at 68°C for 100 seconds, and elongation at 68°C for 7 minutes. The C/EBP{alpha} primers were 5'CACCATGGAGTCGGCCGACTTCT3' and 3'TCACGCGCAGTTGCCCATG5'. After electrophoresis on a 5 percent agarose gel, the C/EBP{alpha} DNA band was isolated with the use of NucleoSpin extract (Macherey-Nagel) and was cloned into a pvDNA3.1D/V5-His6–TOPO vector (Invitrogen) by mixing 4 µl of CEBP{alpha} DNA extract with 1 µl of salt solution (1.2 M sodium chloride and 0.06 M magnesium chloride) and 1 µl of the TOPO vector. The mixture was incubated for five minutes at room temperature, and 2 µl of C/EBP{alpha} vector was transfected into Escherichia coli. The success of transfection was confirmed on the basis of the response to ampicillin. Transfected cells were assessed for C/EBP{alpha} DNA, which was sequenced with the use of an automated sequencer (MWG Biotech).

Cells were transiently transfected with the C/EBP{alpha} expression vector or a green fluorescent protein vector for one hour in serum-free medium containing 1.0 ng of either vector per microliter in Tfx50 reagent (Promega) (ratio of Tfx50 to DNA, 3:1). Transfected cells were then incubated in growth medium for 24 hours in the presence or absence of drugs. The transfection rate was measured in transiently transfected bronchial smooth-muscle cells with the use of a green fluorescent protein vector — that is, a cytomegalovirus-epidermal growth factor promoter–driven vector (p-d2EGFP-N1, Clontech). Transfection was carried out with the use of 1 µg of DNA per milliliter and Tfx50 (ratio, 1:2 to 1:4) for one hour in serum-free medium. Five percent fetal-calf serum was then added to the medium for 24 hours before confocal microscopy of the living cells was performed (model LSM 510, Zeiss). The laser excitation wavelength was 488 nm; fluorescence was detected between 505 and 550 nm with the use of a pinhole aperture of 106 µm. Autofluorescence was not detected between 560 and 615 nm with the use of a wavelength of 543 nm.

Nuclear and Cytosolic Extracts and Electrophoretic Mobility-Shift Assay

Nuclear and cytosolic extracts were prepared from cultures that were 80 percent confluent, as described previously.25 Bronchial smooth-muscle cells were scraped off 175-cm2 flasks and centrifuged at 5000xg for 2 minutes at 4°C, and the pellet was resuspended in 80 µl of low-salt buffer (20 mM HEPES [pH 7.9], 10 mM potassium chloride, 0.1 mM sodium vanadate, 1 mM EDTA, 1 mM EGTA, 0.2 percent NP-40, 10 percent glycerol, and complete protease inhibitor [Roche Diagnostics]) and incubated for 10 minutes at 4°C. After centrifugation at 13,000xg for one minute at 4°C, the supernatant (the cytosolic fraction) was collected. The remaining pellet was dissolved in 50 µl of high-salt buffer (420 mM sodium chloride, 20 mM HEPES at pH 7.9, 10 mM potassium chloride, 0.1 mM sodium vanadate, 1 mM EDTA, 1 mM EGTA, 20 percent glycerol, and complete protease inhibitor), kept on ice for 30 minutes, and centrifuged at 13,000xg for 5 minutes at 4°C. The supernatant collected was considered the nuclear fraction.25,26,28 The protein level was determined with the use of the Bradford assay.

Immunoblotting

Proteins were fractionated according to size, as follows: 5 µg of total protein was applied to a polyacrylamide–sodium dodecyl sulfate gel with a gradient of 4 to 15 percent and transferred to polyvinyledine fluoride membranes (Millipore) according to standard protocols; transfer was confirmed by Ponceau's staining.17,25 Membranes were blocked by the addition of 5 percent skim milk in 10 mM TRIS, 150 mM sodium chloride, and 0.05 percent Tween 20 for 1 hour; incubated for 12 hours at 4°C with a primary monoclonal antibody specific for the glucocorticoid receptor (sc-100X), C/EBP{alpha} (sc-61X), or c-Fos/activator protein-1 (AP-1) (sc-253X) (all Santa Cruz Biotechnology); washed three times in blocking solution; and then incubated with a secondary antirabbit antibody conjugated with horseradish peroxidase (sc-2054, Santa Cruz Biotechnology) for 1 hour. Membranes were washed three times with blocking buffer and once with phosphate-buffered saline, and protein bands were visualized by means of chemiluminescence (ECL, Pierce).

DNA-binding proteins were characterized by means of an electrophoretic mobility-shift assay with the use of a 32P-labeled glucocorticoid-responsive element or CCAAT-binding oligonucleotide (sc-2545 and sc-2525, respectively; Santa Cruz Biotechnology) as described previously.25 We also used a 32P-labeled p21(Waf1/Cip1) promoter fragment containing the C/EBP-binding sites (a gift from Dr. B. Vogelstein, Johns Hopkins University, Baltimore),29 which has been used by others to characterize the glucocorticoid receptor–C/EBP{alpha} DNA consensus sequence of the p21(Waf1/Cip1) promoter,23,24,27 and which we have previously used to show the formation of the glucocorticoid receptor–C/EBP{alpha} complex.25 Supershift assays (defined by a mobility shift of the p21 promoter fragment) were performed by incubating nuclear extracts with one of the above antibodies (1 mg per milliliter) specific for the glucocorticoid receptor, C/EBP{alpha}, or the transcription factor AP-1 overnight at 4°C; DNA–protein complexes and supershifts were analyzed on a nondenaturing 4 percent polyacrylamide gel exposed to x-ray films. The specificity of the observed DNA–protein complexes was characterized by preincubating the extracts with 10 times the normal amount of competitive, unlabeled glucocorticoid-responsive element or CCAAT oligonucleotides.25,26,28

Coimmunoprecipitation of the Glucocorticoid Receptor or C/EBP-{alpha}

Coimmunoprecipitations were performed as described previously.25 Extracts of nuclear protein (20 µl) were incubated overnight at 4°C with antibody against C/EBP{alpha} (1 µg per milliliter) or against glucocorticoid receptor (1 µg per milliliter, Santa Cruz) and then incubated for one hour with protein A Sepharose (1 mg per milliliter) in phosphate-buffered saline at 37°C. After centrifugation at 5000xg for five minutes, the precipitate was washed twice with 2 ml of phosphate-buffered saline and then resuspended in Laemmli buffer and analyzed by means of immunoblotting.25

Interleukin-6 Enzyme-Linked Immunosorbent Assay

Cell-culture medium was collected 0, 6, 12, and 24 hours after stimulation of cells with 5 percent fetal-calf serum in the presence or absence of drugs or antisense oligonucleotides. The release of interleukin-6 was detected by means of an enzyme-linked immunosorbent assay (Quantikine, R&D Systems).

Statistical Analysis

Analysis of variance and an unpaired Student's t-test were used to assess the data for cell counts and [3H]thymidine incorporation. Results were considered significant if the two-sided P value was less than 0.05.

Results

The clinical characteristics of all 54 study subjects from whom we obtained cells for bronchial smooth-muscle cell cultures are shown in Table 1. There were 35 males and 19 females. Owing to the wide range of ages among subjects with asthma, the mean age of this group did not differ significantly from that of the other two groups (Table 1).

Figure 1A shows a representative time course of budesonide-induced (10–8 M) translocation of glucocorticoid receptor from the cytosol to the nucleus in bronchial smooth-muscle cell lines from subjects with asthma and those with emphysema. Budesonide activated the glucocorticoid receptor within 30 minutes, with levels peaking at 1 hour and declining thereafter. Similar time courses were observed for dexamethasone, prednisolone, and hydrocortisone at concentrations ranging from 10–9 to 10–6 M. As summarized in Figure 1B, the time course of the activation of the glucocorticoid receptor by budesonide was similar among bronchial smooth-muscle cell lines from 10 controls, 8 subjects with emphysema, and 12 subjects with asthma, and the time course of the accumulation of glucocorticoid receptors in the nucleus was similar for all four glucocorticoids, with no significant differences in efficacy (data not shown). A second, minor band appeared soon after glucocorticoid treatment (Figure 1A). This band may represent the {beta} isoform of the glucocorticoid receptor but represents only a small proportion of the total.


View larger version (40K):
[in this window]
[in a new window]
 
Figure 1. Immunoblotting, Densitometric Analysis, and Electrophoretic Mobility-Shift Assays in Bronchial Smooth-Muscle Cells from Subjects with Asthma and Those without Asthma.

Panel A shows a representative immunoblot of the distribution of the glucocorticoid receptor (GR) in the cytosol and the nucleus of bronchial smooth-muscle cells from a subject with asthma and a subject with emphysema in the presence of 10–8 M budesonide. {alpha} and {beta} denote the {alpha} and {beta} isoforms of the GR. Panel B shows a densitometric analysis of the nuclear location of the GR over time in the presence of 10–8 M budesonide in bronchial smooth-muscle cells from 10 controls, 8 subjects with emphysema, and 12 subjects with asthma. Bars represent the mean ±SE. Panels C and D show the time course of budesonide-induced binding of the GR to the glucocorticoid-responsive element (GRE) in a representative electrophoretic mobility-shift assay of bronchial smooth-muscle cells from one subject with asthma and one without asthma, respectively.

 
The activation of the glucocorticoid receptor by glucocorticoids and its binding to a glucocorticoid-responsive element oligonucleotide were confirmed by electrophoretic mobility-shift assays in bronchial smooth-muscle cells from subjects with asthma (Figure 1C) and those without asthma (Figure 1D). Similar results were obtained in all other lines of bronchial smooth-muscle cells (six asthma cell lines and six nonasthma cell lines).

To determine the antiinflammatory effect of glucocorticoids, we analyzed the cell-culture medium of the above experiments for the presence of interleukin-6. After adjustment for the cell numbers, the level of secretion of interleukin-6 induced by the addition of 5 percent fetal-calf serum after 24 and 48 hours was similar between bronchial smooth-muscle cells from 10 subjects with asthma and bronchial smooth-muscle cells from 10 subjects without asthma (Figure 2A). All glucocorticoids significantly inhibited the serum-induced secretion of interleukin-6 (P<0.001).


View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Effect of Glucocorticoids on Serum-Induced Secretion of Interleukin-6.

In Panel A, bronchial smooth-muscle cells were stimulated with 5 percent fetal-calf serum (FCS) for 24 hours alone and in combination with a glucocorticoid, and interleukin-6 levels in the cell-culture medium were determined by ELISA. Bars represent the mean (+SE) values in bronchial smooth-muscle cells from 10 subjects with asthma and 10 without asthma. Panel B shows a representative immunoblot of the time course of serum-induced expression of C/EBP{alpha} protein in bronchial smooth-muscle cells from a subject without asthma and its inhibition by transient transfection with 1.0 µM C/EBP{alpha} antisense oligonucleotide. In Panel C, pretreatment of the cells for 1 hour with 10–7 M mifepristone substantially reduced the inhibitory effect of the glucocorticoids on serum-induced interleukin-6 secretion, whereas pretreatment with 1 µM C/EBP{alpha} antisense oligonucleotide for 24 hours had no significant effect. Bars represent the mean (+SE) values in bronchial smooth-muscle cells from 10 subjects with asthma and 10 controls.

 
To characterize the effect of the inhibitory signaling pathway of glucocorticoids on the secretion of interleukin-6, we treated cells with either the glucocorticoid-receptor inhibitor mifepristone (10–7 M) or a C/EBP{alpha} antisense or sense oligonucleotide. The addition of 1.0 µM C/EBP{alpha} antisense oligonucleotide resulted within 24 hours in the down-regulation of serum-induced C/EBP{alpha} protein expression in total cell-protein extracts in bronchial smooth-muscle cells from subjects without asthma (Figure 2B).

When cells were pretreated for one hour with 10–7 M mifepristone, the inhibitory effect of the glucocorticoids on the secretion of interleukin-6 was substantially reduced (Figure 2C). However, preincubation for 24 hours with 1 µM C/EBP{alpha} antisense oligonucleotides did not significantly alter the inhibitory effect of the glucocorticoids on the serum-induced secretion of interleukin-6.

Previously, we reported that a single dose of 10–8 M budesonide led to a mean (±SE) maximal decrease of 21±4 percent in the serum-induced proliferation of bronchial smooth-muscle cells from subjects without asthma.26 In the present study, we observed a similar inhibition of fetal-calf serum–stimulated cell proliferation after three days of culture in the presence of any one of the four glucocorticoids studied after a single treatment on day 1 (Figure 3A). In bronchial smooth-muscle cells from 10 subjects, 10–8 M budesonide reduced the serum-dependent proliferation of cells by 28±4 percent (P<0.01 by an unpaired Student's t-test), 10–8 M dexamethasone reduced proliferation by 21±4 percent (P<0.01), and 10–8 M prednisolone reduced proliferation by 24±3 percent (P<0.01), whereas 10–8 M hydrocortisone did not inhibit proliferation significantly (Figure 3A). A comparison of Figure 3A and Figure 3B shows that bronchial smooth-muscle cells from 15 subjects with asthma grew about 1.5 times as fast as bronchial smooth-muscle cells from subjects without asthma, a finding that is similar to our previous findings.3 Surprisingly, none of the glucocorticoids inhibited the proliferation of bronchial smooth-muscle cells from subjects with asthma (Figure 3B).


View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. The Antiproliferative Efficacy of Glucocorticoids in Bronchial Smooth-Muscle Cells from Subjects with Asthma and Those without Asthma.

Subconfluent cultures of bronchial smooth-muscle cells from 10 subjects without asthma (Panel A) and 15 subjects with asthma (Panel B) were incubated for three days in the presence of 5 percent fetal-calf serum (FCS) in the presence and absence of a single dose of a glucocorticoid on day 1, and then the absolute numbers of cells were determined. In Panel C, the antiproliferative effect of three days of treatment with glucocorticoids was evaluated in bronchial smooth-muscle cells from five subjects without asthma and six with asthma. In Panel D, the antiproliferative effect of the four glucocorticoids was confirmed on the basis of [3H]thymidine incorporation in bronchial smooth-muscle cells from five subjects without asthma and six with asthma. Bars represent means +SE.

 
To investigate whether the absence of antiproliferative action of glucocorticoids on bronchial smooth-muscle cells from subjects with asthma could be overcome by long-term treatment, we exchanged the culture medium and drugs daily over a period of three days. In bronchial smooth-muscle cells from 8 subjects without asthma, long-term treatment resulted in a stronger antiproliferative effect of the glucocorticoids than did a single treatment, but it had no significant effect on bronchial smooth-muscle cells from 10 subjects with asthma (Figure 3C). The absence of an antiproliferative effect of glucocorticoids was confirmed by assessing [3H]thymidine incorporation in the two groups of smooth-muscle cells (Figure 3D).

Given our previous results,25,26 we assessed the role of C/EBP{alpha} in glucocorticoid-inhibited proliferation of bronchial smooth-muscle cells. As shown in a set of representative immunoblots (Figure 4A), bronchial smooth-muscle cells from 20 subjects with asthma did not express C/EBP{alpha}, whereas serum-starved bronchial smooth-muscle cells from 8 subjects with emphysema and 15 controls expressed the 46-kD C/EBP{alpha} protein. The expression of C/EBP{alpha} could be induced by 5 percent fetal-calf serum within 24 hours in all bronchial smooth-muscle cells from subjects without asthma (Figure 2B and Figure 4A). However, bronchial smooth-muscle cells from 4 of the 20 subjects with asthma expressed a smaller protein that reacted with the antibody against C/EBP{alpha} antibody (Figure 4A). However, to visualize these smaller protein bands, we had to double the duration of exposure of the immunoblots.


View larger version (57K):
[in this window]
[in a new window]
 
Figure 4. Expression of C/EBP{alpha} in Bronchial Smooth-Muscle Cells from Subjects with Asthma and Those without Asthma.

Panel A shows four immunoblots of bronchial smooth-muscle cells representative of the findings in 8 subjects with emphysema and 20 subjects with asthma. Subconfluent cultures of bronchial smooth-muscle cells were incubated with 0.1 percent fetal-calf serum (FCS) for 24 hours and then stimulated with 5 percent FCS. C/EBP{alpha} expression was determined in total cell lysates. Panel B shows representative immunoblots of the expression of C/EBP{alpha} in total-protein extract isolated from peripheral-blood lymphocytes in four subjects with asthma and four without asthma. Panel C shows representative immunoblots of C/EBP{alpha} expression in bronchial smooth-muscle cells from three subjects with asthma that were transiently transfected with an expression vector containing the complementary DNA encoding human peripheral-blood lymphocyte–derived C/EBP{alpha}. Cells were transiently transfected in the presence of 5 percent FCS with 1 ng of C/EBP{alpha} expression vector DNA per microliter for 24 and 48 hours. Panel D shows the efficacy of transient transfection on immunofluorescence. The arrows indicate the cells that express the green fluorescent protein and that therefore have been successfully transfected. Panel E shows a representative electrophoretic mobility-shift assay of p21(Waf1/Cip1) promoter–binding proteins with the use of nuclear extracts from bronchial smooth-muscle cells treated for three hours with 10–8 M budesonide. Lane 1 shows the p21(Waf1/Cip1) promoter fragment alone, lane 2 the promoter with nuclear extracts of budesonide-treated bronchial smooth-muscle cells from subjects without asthma, lane 3 the same extract as in lane 2 but with 10 times the normal amount of cold CCAAT oligonucleotides, lane 4 antibody against C/EBP{alpha} and nuclear extracts of bronchial smooth-muscle cells from subjects without asthma, lane 5 antibody against C/EBP{alpha} and nuclear extracts of bronchial smooth-muscle cells from subjects with asthma, lane 6 antibody against the glucocorticoid receptor (GR) and nuclear extracts from bronchial smooth-muscle cells from subjects without asthma, lane 7 antibody against GR and nuclear extracts of bronchial smooth-muscle cells from subjects with asthma, lane 8 antibody against c-Fos/AP-1 and nuclear extracts of bronchial smooth-muscle cells from subjects without asthma, and lane 9 antibody against c-Fos/AP-1 and nuclear extracts of bronchial smooth-muscle cells from subjects with asthma.

 
To determine whether the absence of C/EBP{alpha} is a pathophysiological characteristic present in cell types other than bronchial smooth-muscle cells, we isolated peripheral-blood lymphocytes from four subjects with asthma and four without asthma. We detected C/EBP{alpha} protein in all the samples (Figure 4B).

To overcome the absence of C/EBP{alpha} in bronchial smooth-muscle cells from subjects with asthma, we transiently transfected three such cell lines with an expression vector for the human C/EBP{alpha} isolated from bronchial smooth-muscle cells from subjects without asthma. Immunoblotting revealed a time-dependent increase in the expression of C/EBP{alpha} within 24 and 48 hours after transfection (Figure 4C). The smooth-muscle cells expressed two proteins that reacted with the antibody against C/EBP{alpha} (Figure 4C). According to the molecular-weight markers, the upper band appeared at the expected size for C/EBP{alpha}, whereas the smaller band was similar to the second C/EBP{alpha} band that was observed in nontransfected bronchial smooth-muscle cells from subjects with asthma (Figure 4A and Figure 4C). The rate of transfection was controlled with the use of a cytomegalovirus epidermal growth factor promoter–driven vector; the level of expression of epidermal growth factor by bronchial smooth-muscle cells was 62 percent 24 hours after transfection (Figure 4D).

The absence of C/EBP{alpha} in bronchial smooth-muscle cells from subjects with asthma was confirmed with the use of a supershift electrophoretic mobility-shift assay with a p21(Waf1/Cip1) promoter fragment containing the glucocorticoid receptor–C/EBP{alpha} complex binding site23,24,25,27,29 as the target for C/EBP{alpha} proteins, in the presence and absence of antibodies specific for C/EBP{alpha} or the glucocorticoid receptor; antibodies against c-Fos/AP-1 protein served as a negative control. As shown in Figure 4E, incubation of the p21(Waf1/Cip1) promoter fragment with nuclear-protein extracts that were obtained from bronchial smooth-muscle cells from subjects without asthma in the presence of 10–8 M budesonide for three hours resulted in a defined signal that could be abrogated by incubation with 10 times the normal amount of cold CCAAT oligonucleotide overnight at 4°C. When the complex formed by the p21(Waf1/Cip1) promoter fragment and the nuclear-protein extracts of budesonide-treated bronchial smooth-muscle cells was further incubated with antibodies specific for C/EBP{alpha}, the level of the complex increased and its migration was further delayed (Figure 4E, lane 4). A similar supershift was observed when the p21(Waf1/Cip1) promoter fragment formed a complex with the nuclear-protein extract of budesonide-treated bronchial smooth-muscle cells from subjects without asthma and was incubated with antibodies specific for the glucocorticoid receptor (Figure 4E, lane 6), whereas no such supershift was detected when we used antibodies against c-Fos/AP-1 (lane 8). In contrast, the nuclear-protein fraction obtained from budesonide-treated bronchial smooth-muscle cells from subjects with asthma did not produce any clear signal when they were incubated with the p21(Waf1/Cip1) promoter fragment (Figure 4E, lanes 5, 7, and 9).

To further assess the role of C/EBP{alpha} in bronchial smooth-muscle cells from subjects with asthma, we transiently transfected subconfluent cultures with an expression vector for human C/EBP{alpha} or the empty vector as a control (Figure 5A). The level of the C/EBP{alpha} protein in nuclear extracts of bronchial smooth-muscle cells from subjects with asthma increased within 48 hours in the presence of budesonide (Figure 5A, lanes 1 and 2), preincubation with 10 times the normal level of unlabeled CCAAT oligonucleotide diminished the signal (Figure 5A, lane 3), and no signal was observed when the cells were transfected with the empty control vector for 48 hours (Figure 5A, lane 4). When the extract was subsequently incubated with antibodies specific for C/EBP{alpha}, migration of the DNA-protein band was retarded (Figure 5A, lane 5), whereas there was no signal when the cells were transfected with the empty control vector (Figure 5A, lane 6). We observed no supershifts when the same extracts were incubated in the presence of antibodies against c-Fos/AP-1 (Figure 5A, lane 7), whereas a supershift was observed in the presence of antibodies against glucocorticoid receptor (Figure 5A, lane 8). Bronchial smooth-muscle cells transfected with an empty vector did not show a supershift in the presence of antibodies against the glucocorticoid receptor (Figure 5A, lane 9).


View larger version (26K):
[in this window]
[in a new window]
 
Figure 5. The Glucocorticoid Receptor (GR)–C/EBP{alpha} Complex and Its Antiproliferative Function in Bronchial Smooth-Muscle Cells from Subjects with Asthma.

Panel A shows a representative electrophoretic mobility-shift assay of nuclear extracts of bronchial smooth-muscle cells from subjects with asthma that were transiently transfected for 24 hours (lane 1) or 48 hours (lane 2) with C/EBP{alpha} expression vector and incubated for the last 3 hours with 10–8 M budesonide. Lane 3 shows the C/EBP{alpha} vector with 10 times the normal amount of unlabeled CCAAT oligonucleotide, lane 4 empty control vector, lane 5 C/EBP{alpha} vector with antibody against C/EBP{alpha}, lane 6 empty control vector with antibody against C/EBP{alpha}, lane 7 C/EBP{alpha} vector with antibody against c-Fos/AP-1, lane 8 C/EBP{alpha} vector with antibody against GR, and lane 9 empty control vector with antibody against GR. Panel B shows representative immunoblot analysis of the GR and C/EBP{alpha} protein in bronchial smooth-muscle cells stimulated with budesonide for 0, 1, or 3 hours from two subjects without asthma and two with asthma in the presence and absence of transient (24-hour) transfection with the C/EBP{alpha} expression vector (1 ng per microliter); rec denotes recombinant. Panel C shows the effect of transfection with the C/EBP{alpha} expression vector on the proliferation of bronchial smooth-muscle cells from four subjects with asthma. Cells were transfected with C/EBP{alpha} expression vector (1 ng per microliter) for 24 hours in the presence of either 5 percent fetal-calf serum (FCS) or 10–8 M budesonide, and the empty vector was used as a control. Bars represent means +SE, and each cell line was tested in duplicate.

 
To investigate whether, in asthmatic bronchial smooth-muscle cells from subjects with asthma, transient transfection with the human C/EBP{alpha} expression vector reestablished the formation of the glucocorticoid receptor–C/EBP{alpha} complex previously noted in bronchial smooth-muscle cells from subjects without asthma,25,26 we performed coimmunoprecipitation experiments with the use of nuclear extracts of bronchial smooth-muscle cells that had been incubated with 10–8 M budesonide for three hours (Figure 5B). Western blot analysis of the coimmunoprecipitates showed a clear band for C/EBP{alpha} when we used an antibody against the glucocorticoid receptor for immunoprecipitation and for the glucocorticoid receptor when an antibody against C/EBP-{alpha} was used. In contrast, nontransfected bronchial smooth-muscle cells from subjects with asthma did not show any signal for either C/EBP{alpha} or the glucocorticoid receptor. However, when these bronchial smooth-muscle cells were transfected with a human C/EBP{alpha} expression vector 48 hours before stimulation with budesonide and nuclear extracts were prepared 3 hours after the addition of the drug and subsequent coimmunoprecipitation, we observed a band for C/EBP{alpha} when an antibody against the glucocorticoid receptor was used, as well as a band for the receptor when an antibody against C/EBP{alpha} was used (Figure 5B).

We obtained further evidence of the function of the transfected C/EBP{alpha} expression vector in bronchial smooth-muscle cells from subjects with asthma by counting cells. The numbers of cells in five such nontransfected cell lines doubled within three days in the presence of 5 percent fetal-calf serum, and daily treatment with budesonide (10–8 M) did not significantly alter cell growth (Figure 5C). Transient transfection with an expression vector for human C/EBP{alpha} significantly slowed the proliferation of smooth-muscle cells in the presence of fetal-calf serum (by 30±4.9 percent, P<0.01 by an unpaired Student's t-test), on the basis of the increase in the numbers of cells from day 1 to day 3 in the presence of 5 percent fetal-calf serum. Transfection with the empty vector did not inhibit proliferation. In contrast, transfected cells treated daily with 10–8 M budesonide had a further reduction of proliferation, as compared with transfected cells that were not treated with budesonide (Figure 5C). The additional effect of the glucocorticoid on the inhibitory effect of the C/EBP{alpha} expression vector was significant (P<0.01) in bronchial smooth-muscle cells from five subjects with asthma and was significantly different (P<0.01) from the effect achieved with the C/EBP{alpha} vector alone. The presence of the empty vector together with budesonide did not inhibit the proliferation of bronchial smooth-muscle cells from subjects with asthma.

Discussion

Our data indicate that the proliferation of airway smooth-muscle cells in patients with asthma may result from an absence of C/EBP{alpha}. The absence of C/EBP{alpha} also explains why the antiproliferative action of glucocorticoids on these cells was absent, while the glucocorticoid-induced suppression of interleukin-6 was not affected. Since peripheral-blood lymphocytes had normal levels of C/EBP{alpha}, we propose that the absence of C/EBP-{alpha} is cell-type–specific.

Hypertrophy and hyperplasia are characteristic of the bronchial smooth-muscle bundles in asthmatic airways, and this increased layer of bronchial smooth muscle may explain the hyperresponsiveness of asthmatic bronchi.1,2,4 It may also explain the local recruitment of immunocompetent cells into the smooth muscle, leading to chronic inflammation.1,2,4 Glucocorticoids are potent suppressors of this chronic inflammation and are the mainstay of therapy for moderate and severe asthma.5,6,7,8,9,10,11

Impaired expression of the glucocorticoid receptor or a mutation in it has been linked to asthma but has never been proved to play a causative role.30,31,32 The expression of the receptor has been assumed to be faulty in patients with asthma, but no significant differences between patients with asthma and those without asthma have been found in the tissue distribution of the glucocorticoid receptor in lung-biopsy specimens.32 Some data have suggested that the receptor has two isoforms, {alpha} and {beta}, resulting from differential splicing of the same messenger RNA.33 Both isoforms bind to the same DNA consensus sequence. Because the consensus sequence has a higher affinity for the {beta} isoform, it has been assumed that this isoform inhibits binding of the {alpha} isoform,33 but a link between overexpression of the {beta} isoform and the diagnosis of asthma has not been established.34 In our study, glucocorticoids activated the glucocorticoid receptor in all lines of bronchial smooth-muscle cells, irrespective of the disease state, and we did not observe a stronger signal for the {beta} isoform in bronchial smooth-muscle cells from subjects with asthma than in those without asthma. Furthermore, we did not detect a double band for the receptor in the cytosolic protein fractions, whereas a second protein band that reacted with the antibody against the glucocorticoid receptor became visible only in the nuclear protein fractions early after treatment with a glucocorticoid.

The activation of the glucocorticoid receptor by various glucocorticoids suppressed serum-stimulated secretion of interleukin-6 in all lines of bronchial smooth-muscle cells, and mifepristone reversed this effect. Our data indicate that the inhibition of interleukin-6 secretion by glucocorticoids does not involve C/EBP{alpha} in human bronchial smooth-muscle cells. Therefore, distinct signaling pathways mediate the antiproliferative and the interleukin-6–blocking effects of glucocorticoids. However, the latter effect may include the interaction of the receptor with other transcription factors, including nuclear factor-{kappa}B, AP-1, and signal transducers and activators of transcription (STATs).10,12,13,35,36,37,38

The observed failure of glucocorticoids to inhibit cell proliferation in bronchial smooth-muscle cells from subjects with asthma could not be explained by an absent or defective glucocorticoid receptor. Several studies have shown that the antiproliferative effect of glucocorticoids is mediated by the receptor and C/EBP{alpha},14,23,24,25 and both active transcription factors are required to induce the synthesis of p21(Waf1/Cip1).24,25,27 Moreover, in human cells, including lung fibroblasts, pulmonary and bronchial smooth-muscle cells, and peripheral-blood lymphocytes, the glucocorticoid receptor forms a complex with C/EBP{alpha}, which then binds to the CCAAT DNA consensus sequence in the p21(Waf1/Cip1) promoter.25,27,28 We found that this complex was absent in budesonide-treated bronchial smooth-muscle cells from subjects with asthma, but that it could be reestablished by transfecting the cells with a human C/EBP{alpha} expression vector. Furthermore, transfected cells had a slower rate of proliferation than nontransfected cells, and their proliferation could be inhibited by glucocorticoids. These findings indicate that the absence of C/EBP{alpha} in bronchial smooth-muscle cells from patients with asthma may account for their increased rate of proliferation.3 In addition, direct protein–protein interaction with the glucocorticoid receptor and other transcription factors has been demonstrated only for members of the STAT family13,37,38 for C/EBP{alpha}23,25,27 and C/EBP{beta}.36 Therefore, the receptor may regulate cell proliferation and cell differentiation or apoptosis through its interaction with various members of the C/EBP family. We did not observe any interaction between the glucocorticoid receptor and AP-1, which indicates that this transcription factor is not involved in the p21(Waf1/Cip1) regulating complex consisting of the receptor and C/EBP{alpha}.

Moreover, the antiproliferative action of glucocorticoids was preserved in bronchial smooth-muscle cells from eight subjects with emphysema, and C/EBP{alpha} was also normally expressed in these cells. These observations suggest a difference in the pathogenesis of asthma and emphysema, even though the latter is sometimes regarded as a subtype of asthma.39,40

In conclusion, we have demonstrated that the antiproliferative and the cytokine-inhibitory effects of glucocorticoids are mediated by different signaling pathways. Both pathways involve the activation of the glucocorticoid receptor, but the pathways subsequently diverge. The antiproliferative pathway does not function in patients with asthma because bronchial smooth-muscle cells in these patients lack C/EBP{alpha} protein required to form a complex with the glucocorticoid receptor. The pathological implications of this absence of C/EBP{alpha} require evaluation.

Supported by the Medical Foundation of the University of Sydney, Australia; Freiwillige Akademische Gesellschaft, University of Basel, Switzerland; the National Health and Medical Research Council of Australia; GlaxoSmithKline, Loughborough, United Kingdom; and AstraZeneca, Lund, Sweden.


Source Information

From the Department of Pharmacology and the Woolcock Institute of Medical Research, University of Sydney, Sydney, Australia (M.R., P.R.A.J., P.B., G.G.K., Q.G., K.H., J.K.B., J.L.B.); and the Departments of Research and Internal Medicine, Pulmonary Cell Research, University Hospitals Basel, Basel, Switzerland (M.R., M.P.B., J.J.R., M.T.).

Drs. Johnson, Borger, Black, and Tamm contributed equally to this article.

References

  1. Jeffery PK. Remodeling in asthma and chronic obstructive lung disease. Am J Respir Crit Care Med 2001;164:S28-S38. [Free Full Text]
  2. Jeffery PK. Comparative morphology of the airways in asthma and chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1994;150:S6-S13. [ISI][Medline]
  3. Johnson PRA, Roth M, Tamm M, et al. Airway smooth muscle cell proliferation is increased in asthma. Am J Respir Crit Care Med 2001;164:474-477. [Free Full Text]
  4. Demoly P, Simony-Lafontaine J, Chanez P, et al. Cell proliferation in the bronchial mucosa of asthmatics and chronic bronchitis. Am J Respir Crit Care Med 1994;150:214-217. [Abstract]
  5. Hirst SJ, Lee TH. Airway smooth muscle as a target of glucocorticoid action in the treatment of asthma. Am J Respir Crit Care Med 1998;158:S201-S206. [Free Full Text]
  6. Zitnik RJ, Whiting NL, Elias JA. Glucocorticoid inhibition of interleukin-1-induced interleukin-6 production by human lung fibroblasts: evidence for transcriptional and post-transcriptional regulatory mechanisms. Am J Respir Cell Mol Biol 1994;10:643-650. [Abstract]
  7. Korn SH, Jerre A, Brattsand R. Effects of formoterol and budesonide on GM-CSF and IL-8 secretion by triggered human bronchial epithelial cells. Eur Respir J 2001;17:1070-1077. [Free Full Text]
  8. Pang L, Knox AJ. Synergistic inhibition by {beta}2-agonists and corticosteroids on tumour necrosis factor-{alpha}-induced interleukin-8 release from cultured human airway smooth-muscle cells. Am J Respir Cell Mol Biol 2000;23:79-85. [Free Full Text]
  9. Van der Velden VH. Glucocorticoids: mechanisms of action and anti-inflammatory potential in asthma. Mediators Inflammation 1998;7:229-37.
  10. Adcock IM, Caramori G. Cross-talk between pro-inflammatory transcription factors and glucocorticoids. Immunol Cell Biol 2001;79:376-384. [CrossRef][Medline]
  11. Tsai MJ, O'Malley BW. Molecular mechanisms of action of steroid/thyroid receptor superfamily members. Annu Rev Biochem 1994;63:451-486. [CrossRef][ISI][Medline]
  12. Gougat C, Jaffuel D, Gagliardo R, et al. Overexpression of the human glucocorticoid receptor alpha and beta isoforms inhibits AP-1 and NF-kappaB activities hormone independently. J Mol Med 2002;80:309-318. [CrossRef][ISI][Medline]
  13. Biola A, Andreau K, David M, et al. The glucocorticoid receptor and STAT6 physically and functionally interact in T-lymphocytes. FEBS Lett 2000;487:229-233. [CrossRef][ISI][Medline]
  14. Timichenko NA, Wilde M, Nakanishi M, Smith JR, Darlington GJ. CCAAT/enhancer-binding protein alpha (C/EBP alpha) inhibits cell proliferation through the p21 (WAF-1/CIP-1/SDI-1) protein. Genes Dev 1996;10:804-815. [Free Full Text]
  15. Timichenko NA, Harris TE, Wilde M, et al. CCAAT/enhancer binding protein alpha regulates p21 protein and hepatocyte proliferation in newborn mice. Mol Cell Biol 1997;17:7353-7361. [Abstract]
  16. Ramji DP, Foka P. CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J 2002;365:561-575. [ISI][Medline]
  17. Parkin SE, Baer M, Copeland TD, Schwartz RC, Johnson PF. Regulation of CCAAT/enhancer binding protein (C/EBP) activator proteins by heterodimerization with C/EBP-{gamma} (Ig/EBP). J Biol Chem 2002;277:23563-23572. [Free Full Text]
  18. Eaton EM, Hanlon M, Bundy L, Sealy L. Characterization of C/EBP{beta} isoforms in normal versus neoplastic mammary epithelial cells. J Cell Physiol 2001;189:91-105. [Erratum, J Cell Physiol 2002;190:131.] [CrossRef][Medline]
  19. O'Rourke JP, Hutt JA, DeWille J. Transcriptional regulation of C/EBP{delta} in G(0) growth-arrested mouse mammary epithelial cells. Biochem Biophys Res Commun 1999;262:696-701. [CrossRef][Medline]
  20. Paschen W, Gissel C, Linden T, Althausen S, Doutheil J. Activation of gadd153 expression through transient cerebral ischemia: evidence that ischemia causes endoplasmic reticulum dysfunction. Brain Res Mol Brain Res 1998;60:115-122. [Medline]
  21. Stewart AG, Fernandes D, Tomlinson PR. The effect of glucocorticoids on proliferation of human cultured airway smooth muscle. Br J Pharmacol 1995;166:3219-3226. 
  22. Fernandes D, Guida E, Koutsoubos V, et al. Glucocorticoids inhibit proliferation, cyclin D1 expression, and retinoblastoma protein phosphorylation, but not activity of the extracellular-regulated kinases in human cultured airway smooth muscle. Am J Respir Cell Mol Biol 1999;21:77-88. [Free Full Text]
  23. Cha HH, Cram EJ, Wang EC, Huang AJ, Kasler HG, Firestone GL. Glucocorticoids stimulate p21 gene expression by targeting multiple transcriptional elements within a steroid responsive region of the p21(waf1/cip1) promoter in rat hepatoma cells. J Biol Chem 1998;273:1998-2007. [Free Full Text]
  24. Cram EJ, Ramos RA, Wang EC, Cha HH, Nishio Y, Firestone GL. Role of the CCAAT/enhancer binding protein-{alpha} transcription factor in the glucocorticoid stimulation of p21(waf1/cip1) gene promoter activity in growth-arrested rat hepatoma cells. J Biol Chem 1998;273:2008-2014. [Free Full Text]
  25. Rüdiger JJ, Roth M, Bihl MP, et al. Interaction of C/EBP-{alpha} and the glucocorticoid receptor in vivo and in nontransformed human cells. FASEB J 2002;16:177-184. [Free Full Text]
  26. Roth M, Johnson PRA, Rüdiger JJ, et al. Interaction between glucocorticoids and {beta}2 agonists on bronchial airway smooth muscle cells through synchronised cellular signalling. Lancet 2002;360:1293-1299. [CrossRef][ISI][Medline]
  27. Ramos RA, Meilandt WJ, Wang EC, Firestone GL. Dysfunctional glucocorticoid receptor with a single point mutation ablates the CCAAT/enhancer binding protein-dependent growth suppression response in a steroid-resistant hepatoma cell variant. FASEB J 1999;13:169-180. [Free Full Text]
  28. Eickelberg O, Roth M, Lörx R, et al. Ligand-independent activation of the glucocorticoid receptor by {beta}2-adrenergic receptor agonists in primary human lung fibroblasts and vascular smooth muscle cells. J Biol Chem 1999;274:1005-1010. [Free Full Text]
  29. el-Deiry WS, Tokino T, Wladman T, et al. Topological control of p21WAF1/CIP1 expression in normal and neoplastic tissues. Cancer Res 1995;55:2910-2919. [Free Full Text]
  30. Lane SJ, Arm JP, Staynov DZ, Lee TH. Chemical mutation analysis of the human glucocorticoid receptor cDNA in glucocorticoid-resistant bronchial asthma. Am J Respir Cell Mol Biol 1994;11:42-48. [Abstract]
  31. Corrigan CJ, Brown PH, Barnes NC, et al. Glucocorticoid resistance in chronic asthma: glucocorticoid pharmacokinetics, glucocorticoid receptor characteristics, and inhibition of peripheral blood T cell proliferation by glucocorticoids in vitro. Am Rev Respir Dis 1991;144:1016-1025. [ISI][Medline]
  32. Adcock IM, Gilbey T, Gelder CM, Chung KF, Barnes PJ. Glucocorticoid receptor localization in normal and asthmatic lung. Am J Respir Crit Care Med 1996;154:771-782. [Abstract]
  33. Sousa AR, Lane SJ, Cidlowski JA, Staynov DZ, Lee TH. Glucocorticoid resistance in asthma is associated with elevated in vivo expression of the glucocorticoid receptor beta-isoform. J Allergy Clin Immunol 2000;105:943-950. [CrossRef][ISI][Medline]
  34. Gagliardo R, Chanez P, Vignola AM, et al. Glucocorticoid receptor alpha and beta in glucocorticoid dependent asthma. Am J Respir Crit Care Med 2000;162:7-13. [Free Full Text]
  35. Wilson SJ, Wallin A, Della-Cioppa G, Sandstrom T, Holgate ST. Effects of budesonide and formoterol on NF-kappaB, adhesion molecules, and cytokines. Am J Respir Crit Care Med 2001;164:1047-1052. [Free Full Text]
  36. Gotoh T, Chowdhury S, Takiguchi M, Mori M. The glucocorticoid-responsive gene cascade: activation of the rat arginase gene through induction of C/EBPbeta. J Biol Chem 1997;272:3694-3698. [Free Full Text]
  37. Zhang Z, Jones S, Hagood JS, Fuentes GM, Fuller GM. STAT3 acts as a co-activator of glucocorticoid receptor signalling. J Biol Chem 1997;272:30607-30610. [Free Full Text]
  38. Stocklin E, Wissler M, Gouilleux F, Groner B. Functional interaction between Stat5 and the glucocorticoid receptor. Nature 1996;383:726-728. [CrossRef][Medline]
  39. Sutherland ER, Martin RJ. Airway inflammation in chronic obstructive pulmonary disease: comparisons with asthma. J Allergy Clin Immunol 2003;112:819-827. [CrossRef][ISI][Medline]
  40. Bellia V, Battaglia S, Catalano F, et al. Aging and disability affect misdiagnosis of COPD in elderly asthmatics: the SARA study. Chest 2003;123:1066-1072. [Free Full Text]

 

This Article
-Abstract
- PDF
-PDA Full Text
-PowerPoint Slide Set

Commentary
-Perspective
 by Shore, S. A.
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited
-E-mail When Letters Appear

More Information
-PubMed Citation

Related Letters:

C/EBP{alpha} in Asthma
Levy D. I., Roth M., Borger P., Tamm M.
Extract | Full Text | PDF  
N Engl J Med 2004; 351:2236-2237, Nov 18, 2004. Correspondence

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved.