Decreased Histone Deacetylase Activity in Chronic Obstructive Pulmonary Disease
Kazuhiro Ito, Ph.D., Misako Ito, B.A., W. Mark Elliott, Ph.D., Borja Cosio, M.D., Gaetano Caramori, Ph.D., Onn Min Kon, M.D., Adam Barczyk, M.D., Shizu Hayashi, Ph.D., Ian M. Adcock, Ph.D., James C. Hogg, M.D., and Peter J. Barnes, D.M., D.Sc.
Background Chronic obstructive pulmonary disease (COPD) is characterizedby chronic airway inflammation that is greater in patients withadvanced disease. We asked whether there is a link between theseverity of disease and the reduction in histone deacetylase(HDAC) activity in the peripheral lung tissue of patients withCOPD of varying severity. HDAC is a key molecule in the repressionof production of proinflammatory cytokines in alveolar macrophages.
Methods HDAC activity and histone acetyltransferase (HAT) activitywere determined in nuclear extracts of specimens of surgicallyresected lung tissue from nonsmokers without COPD, patientswith COPD of varying severity, and patients with pneumonia orcystic fibrosis. Alveolar macrophages from nonsmokers, smokers,and patients with COPD and bronchial-biopsy specimens from nonsmokers,healthy smokers, patients with COPD, and those with mild asthmawere also examined. Total RNA extracted from lung tissue andmacrophages was used for quantitative reverse-transcriptase–polymerase-chain-reactionassay of HDAC1 through HDAC8 and interleukin-8. Expression ofHDAC2 protein was quantified with the use of Western blotting.Histone-4 acetylation at the interleukin-8 promoter was evaluatedwith the use of a chromatin immunoprecipitation assay.
Results Specimens of lung tissue obtained from patients withincreasing clinical stages of COPD had graded reductions inHDAC activity and increases in interleukin-8 messenger RNA (mRNA)and histone-4 acetylation at the interleukin-8 promoter. ThemRNA expression of HDAC2, HDAC5, and HDAC8 and expression ofthe HDAC2 protein were also lower in patients with increasingseverity of disease. HDAC activity was decreased in patientswith COPD, as compared with normal subjects, in both the macrophagesand biopsy specimens, with no changes in HAT activity, whereasHAT activity was increased in biopsy specimens obtained frompatients with asthma. Neither HAT activity nor HDAC activitywas changed in lung tissue from patients with cystic fibrosisor pneumonia.
Conclusions Patients with COPD have a progressive reductionin total HDAC activity that reflects the severity of the disease.
The global burden of chronic obstructive pulmonary disease (COPD)— a common and debilitating chronic inflammatory diseasethat is characterized by the progressive development of airflowlimitation and is poorly reversible — is increasing.1Cigarette smoking is strongly linked with the ongoing inflammationin the airways and lung parenchyma, and the severity of airflowlimitation is correlated with the degree of pulmonary inflammation.2,3
The inflammatory processes in COPD are complex.4 Neutrophilchemotactic mediators, such as interleukin-8 and leukotrieneB4, and proinflammatory cytokines, such as tumor necrosis factor, are increased in the sputum of patients with COPD, as comparedwith that of normal subjects.5 Histone acetyltransferase (HAT)and histone deacetylase (HDAC) are families of nuclear enzymesthat modify the expression of inflammatory genes by regulatingchromatin structure.6 Acetylation of the core histones by transcriptionalcoactivator proteins, which possess intrinsic HAT activity,leads to changes in the chromatin structure that subsequentlyallow the transcription factors and RNA polymerase II to bindto DNA and enhance gene transcription. Conversely, deacetylationof the core histones is generally associated with the repressionof transcription.
We have previously shown that HDAC is a key molecule in therepression of production of proinflammatory cytokines in alveolarmacrophages7; thus, a decrease in the HDAC could be associatedwith enhanced inflammation in COPD.8 The present study was designedto test the hypothesis that the magnitude of the inflammatoryresponse in the peripheral lung that has been described in COPDis associated with a decrease in HDAC activity.
Methods
Patients
We followed the guidelines for grading disease severity in COPDof the Global Initiative for Obstructive Lung Disease9: stage0 denotes normal measurements on spirometry with chronic symptoms(i.e., cough and sputum); stage 1 denotes mild disease, witha ratio of forced expiratory volume in one second (FEV1) toforced vital capacity (FVC) of less than 70 percent and an FEV1of more than 80 percent of the predicted value with or withoutsymptoms (i.e., cough and sputum); stage 2 denotes moderatedisease, with an FEV1:FVC ratio of less than 70 percent andan FEV1 of 80 to 50 percent of the predicted value with or withoutsymptoms (i.e., cough, sputum, and dyspnea); stage 3 denotessevere disease, with an FEV1 of 50 to 30 percent of the predictedvalue; and stage 4 denotes very severe disease, with an FEV1of less than 30 percent of the predicted value.
We obtained specimens of lung tissue and data on patients' lungfunction from a tissue bank that was linked to an establishedpatient registry.10 Specimens of peripheral lung tissue wereobtained from 11 patients who were nonsmokers without symptomswho had normal lung function and from 29 patients who were smokers:9 with stage 0 COPD, 10 with stage 1 COPD, and 10 with stage2 COPD. Specimens of peripheral lung tissue were obtained froman additional six patients with stage 4 COPD who were undergoinglung-volume–reduction surgery. The patient registry andthe tissue bank also provided specimens of peripheral lung tissuefrom five patients who had a tumor that had produced obstructivepneumonia, as well as from five explanted lungs of patientswith cystic fibrosis. Baseline characteristics of the patientsare summarized in Table 1.
Alveolar macrophages were obtained by bronchoalveolar lavagefrom six healthy nonsmokers, six healthy current smokers, andseven patients with stage 2 or 3 COPD (Table 2). Bronchial-biopsyspecimens were collected from 14 normal subjects who were nonsmokers,10 patients with mild asthma and 13 age-matched subjects whowere smokers, and 7 patients with COPD (stage 2 or 3) and 10age-matched smokers (Table 2). Normal healthy subjects for bronchoscopystudies were volunteers recruited through advertisement. Althoughthese samples were not specifically collected for this study,our study was part of a project that examined the molecularmechanism of inflammation in COPD, and it was approved by thelocal research ethics committees. All subjects had providedwritten informed consent for the deposition of their tissuesin the tissue bank from which we obtained the specimens andfor their use in research studies of this type.
Table 2. Characteristics of Subjects Who Provided Specimens of Alveolar Macrophages and Underwent Bronchial Biopsy.
Cell Preparation and Assays
Bronchoalvelolar-lavage fluid was collected as previously described.11Cells from the fluid were centrifuged (at 500xg for 10 minutes)and washed twice with Hanks' salt solution. Cell viability wasassessed with the use of the trypan-blue exclusion method. Macrophagesfrom the bronchoalveolar-lavage fluid were separated by meansof adhesion to plastic and identified as previously described.11In these experiments, the mean (±SE) viability of themacrophages was 66.3±4.7 percent (range, 30 to 95) andthe mean purity was 93.4±1.3 percent (range, 83 to 98).
Preparation of Cell Extracts
Tissue specimens (three pieces approximately 0.5 cm by 0.5 cmby 0.5 cm in size) and biopsy specimens (two pieces approximately1 mm by 1 mm by 3 mm in size) were ground under liquid nitrogenwith the use of a pestle and mortar. Hypotonic buffer (10 mMHEPES–sodium hydroxide, pH 7.9, 1.5 mM magnesium chloride,10 mM potassium chloride, 10 mM 2-mercaptoethanol, and a commerciallyavailable mixture of protease inhibitors [Complete Protease-InhibitorCocktail Tablets, Roche Diagnostics]) were added to the sampleto remove contaminating red cells and secretions and to loosenthe cell membranes. The sample was then left on ice for 15 minutes.NP-40 solution (Sigma), a nonionic detergent, was added to reacha 0.5 percent final concentration, and the samples were vortexedto isolate nuclei by lysing the cell membranes. The sampleswere microcentrifuged (at 3000 rpm for 1 minute), to removethe larger debris, and the supernatants were then microcentrifuged(at 14,000 rpm for 30 seconds), to obtain the nuclear-rich fraction.The nuclei of alveolar macrophages were prepared by means ofsuspension with mild lysis buffer on ice for 10 minutes.12 Nuclearproteins were extracted as previously described.13 The proteinconcentration of each sample was measured (Bradford Bio-RadProtein Assay kit, Bio-Rad), with bovine serum albumin usedas a standard.
HDAC Activity and HAT Activity
HDAC activity and HAT activity were measured with the use ofa nonisotopic assay that used a fluorescent derivative of epsilon-acetyllysine (HDAC Fluorescent Activity Assay Kit, Biomol) and anenzyme immunosorbent assay (HAT Activity Assay Kit, UpstateBiotechnology) to detect antiacetylated lysine antibody on synthesizedhistone-4 partial peptide. The results are expressed as micromolarvalues of the provided standard per microgram of protein.
Total RNA was extracted from approximately 1x106 cells or fromtwo specimens of lung tissue 0.3 cm3 in size with the use ofan RNeasy kit (Qiagen). Reverse transcription was performedwith the use of an Omniscript RT Kit (Qiagen). Gene-transcriptlevels of HDAC1 through HDAC8, housekeeping (unchanging) genes,glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and interleukin-8were quantified by real-time polymerase chain reaction (PCR)with the use of a QuantiTect SYBR Green PCR kit (Qiagen) ona Rotor-Gene 3000 (Corbett Research). Variation in the amountof transcript in different samples was corrected for by GAPDHexpression. Sequences of the primer pairs used for the PCR toidentify HDAC1 through HDAC8, interleukin-8, and GAPDH are givenin Supplement 1 of the Supplementary Appendix (available withthe full text of this article at www.nejm.org).
Chromatin Immunoprecipitation Assay
Samples of lung tissue (three pieces approximately 0.5 cm by0.5 cm by 0.5 cm in size) were immersed in a 3 percent solutionof formaldehyde for one hour in order to fix protein–DNAcomplexes. The tissue was cut into small pieces and homogenizedin a Dounce homogenizer. After removing debris with the useof centrifugation (at 3000 rpm for 30 seconds), chromatin immunoprecipitationwas performed with the use of antiacetylated histone-4 antibodyand a chromatin immunoprecipitation assay kit (Upstate Biotechnology).Quantitative PCR was performed (QuantiTect SYBR Green PCR kit,Qiagen). Primer pairs for the nuclear factor-B (NF-B) bindingsite in the interleukin-8 promoter were 5GGCCATCAGTTGCAAATC3(forward primer) and 5TTCCTTCCGGTGGTTTCTTC3 (reverse primer).Variation in the amount of PCR product in the samples of immunoprecipitatedDNA was corrected for by measuring total DNA before immunoprecipitationwas performed.
Western Blotting
Tissue extracts were analyzed by sodium dodecyl sulfate–polyacrylamide-gelelectrophoresis and Western blot analysis with the use of animmunoblot apparatus (XCell SureLock Mini-Cell and Blot ModuleKit, Invitrogen). Immunoreactive bands were detected by enhancedchemiluminescence (ECL solution, Amersham Biosciences [GE Healthcare])with the use of specific antibodies (Santa Cruz Biotechnology)as previously described.7 Variation of the band density of HDAC2in different samples was corrected for with use of the banddensity of the nuclear membrane proteins lamin A and lamin C(lamin A/C) or the total DNA content in the tissue sample.
Statistical Analysis
Results are expressed as means ±SE. Other measures (mediansand standard deviations) are provided in the Supplementary Appendix.Analysis of variance was performed with the use of the nonparametricKruskal–Wallis test. When the result was significant,the Mann–Whitney U test was performed for comparisonsbetween groups (SPSS software). Correlation coefficients werecalculated with the use of Spearman's rank method. A P valueof less than 0.05 was considered to indicate statistical significance.All reported P values are two-sided.
Results
Peripheral Lung Tissue
Levels of interleukin-8 messenger RNA (mRNA), normalized accordingto the amount of GAPDH, were higher in samples of peripherallung tissue from patients with increasing severity of COPD thanin samples from nonsmokers. There were no significant differencesin the levels of interleukin-8 mRNA between samples from patientswith stage 0 disease (0.45±0.24) or stage 1 disease (0.36±0.17),and samples from nonsmokers (0.12±0.03); however, thedifferences were significant between samples from nonsmokersand those from patients with stage 2 disease (0.59±0.14,P=0.005) or stage 4 disease (0.86±0.13, P=0.001) (Figure 1A).A similar trend was noted in the degree of histone-4 acetylationat the NF-B binding site of the interleukin-8 promoter, andthese differences reached significance in samples from patientswith stage 2 disease (ratio to total immunoprecipitated DNA,0.0014±0.00034) and patients with stage 4 disease (ratioto total immunoprecipitated DNA, 0.0019±0.00044), ascompared with those from nonsmokers (ratio to total immunoprecipitatedDNA, 0.00020±0.00008) (Figure 1A). Expression of interleukin-8mRNA and of histone-4 acetylation in the interleukin-8 promoterwas correlated with increasing clinical severity of disease(stages 0, 1, 2, and 4) in the Spearman correlation analysis(P=0.05 and P=0.01, respectively).
Figure 1. Interleukin-8 Gene Expression and Histone Deacetylase (HDAC) in Peripheral Lung Tissue from Patients with COPD.
Panel A shows interleukin-8 messenger RNA (mRNA) expression and histone-4 acetylation at the interleukin-8 promoter. Panel B shows HDAC activity. Panel C shows histone acetyltransferase (HAT) activity. The data were plotted as means ±SE, with the number of subjects in each group ranging from 5 to 11. (The complete data are given in Supplements 1, 2, and 3 of the Supplementary Appendix.) Panel D shows the correlations between HDAC activity and the ratio of forced expiratory volume in one second (FEV1) to forced vital capacity (FVC) in specimens obtained from normal nonsmokers and from patients with COPD at different stages. The dotted line indicates the 95 percent confidence interval of the regression line. When the single outlier point shown at the top right in this panel was omitted, there was still a significant positive correlation between HDAC activity and FEV1:FVC (r=0.60, P<0.001). S0, S1, S2, and S4 denote severity of disease according to the grading of the Global Initiative for Obstructive Lung Disease, with higher numbers indicating greater severity; PN pneumonia; and CF cystic fibrosis.
Total HDAC activity (expressed as micromolar values of the deacetylatedHDAC substrate standard per microgram of protein) in samplesof lung tissue from nonsmokers was 2.1±0.67 µMof the HDAC standard, and the activity was reduced in patientswith more advanced stages of COPD; as compared with the HDACactivity in samples from nonsmokers, this difference reachedstatistical significance in samples from patients with stage2 disease (HDAC activity, 0.67±0.13 µM, P=0.03)and patients with stage 4 disease (HDAC activity, 0.36±0.077µM, P=0.006) (Figure 1B). Furthermore, in samples frompatients with stage 4 disease, the level of HDAC activity wassignificantly lower than that among patients with stage 0 disease(HDAC activity, 1.0±0.16 µM, P=0.007 for the comparisonbetween patients with stage 0 disease and those with stage 4disease). By contrast, there was no difference in total tissueHAT activity among these groups according to analysis of variance(P=0.46) (Figure 1C). Samples of lung tissue obtained from patientswith pneumonia and patients with cystic fibrosis did not showany significant difference in HDAC activity or HAT activityfrom activity in samples from healthy nonsmokers. (These dataare shown in Supplement 2 of the Supplementary Appendix.)
HDAC activity was significantly correlated with FEV1 (r=0.45,P=0.02), the FEV1:FVC ratio (r=0.60, P<0.001) (Figure 1D),histone-4 acetylation (r=–0.61, P<0.001), and interleukin-8gene expression (r=–0.46, P=0.01) when all subjects wereincluded. Significant correlations were also seen in samplesfrom patients with COPD (stages 0, 1, 2, and 4) between HDACactivity and FEV1 (r=0.43, P=0.001), FEV1:FVC ratio (r=0.55,P<0.001), histone-4 acetylation (r=–0.51, P=0.003),and interleukin-8 gene expression (r=–0.41, P=0.02). However,there was no correlation of HDAC activity with age (P=0.06 forall subjects, and P=0.1 for patients with COPD) or with carbonmonoxide diffusion corrected for alveolar volume (KCO) (P=0.08for all subjects, and P=0.15 for patients with COPD). Therewas no significant correlation between HDAC activity and exposureto cigarettes measured in pack-years (P=0.69) among patientswith COPD (stages 0, 1, 2, and 4). (These data are summarizedin Supplement 3 of the Supplementary Appendix, and individualfigures for correlation are given in Supplement 4 of the Supplementary Appendix.)
We next determined whether reduced HDAC activity was a resultof attenuated expression of the genes for specific HDAC isoformsor a global suppression of all isoforms. The relative expressionof HDAC2 mRNA normalized for GAPDH was reduced in samples oflung tissue from patients with more severe COPD. The significantreduction in the level of HDAC mRNA was found in tissue frompatients with stage 2 disease (0.024±0.0075, 35 percentof the value in nonsmokers), as compared with samples from nonsmokers(0.068±0.017, P=0.03). A further significant reductionwas seen in samples from patients with stage 4 disease (0.016±0.0080,24 percent of the value in nonsmokers), as compared with samplesfrom nonsmokers (P=0.01) and from patients with stage 0 disease(0.048±0.0095, P=0.02) (Figure 2A). The HDAC5 and HDAC8mRNA expression was also significantly reduced in samples frompatients with stage 2 disease and those with stage 4 disease,as compared with levels in those from nonsmokers or from patientswith stage 0 disease, whereas the expression of HDAC1, 3, 4,6, and 7 was not different (Figure 2A). When HDAC2 mRNA expressionwas compared with large ribosomal protein expression insteadof expression of GAPDH, the results were similar (the data areprovided in Supplement 5 of the Supplementary Appendix).
Figure 2. Histone Deacetylase (HDAC) Expression in Peripheral Lung Tissue.
Panel A shows the expression of histone deacetylase (HD) genes 1 through 8 with the use of real-time PCR. Panel B shows HDAC2 protein expression with the use of Western blotting and lamin A and lamin C (lamin A/C) nuclear membrane proteins as an internal control for nuclear-protein loading. Panel C shows the densitometric analysis of HDAC2 protein expression in samples of peripheral lung tissue from healthy nonsmokers (NS) and from patients with COPD stage 0 (S0), stage 1 (S1), stage 2 (S2), and stage 4 (S4). The results are plotted as means ±SE, with the number of subjects in each group ranging from 6 to 11. In Panel A, there were significant differences (asterisks indicate P<0.05 and daggers P<0.01 for the comparison with nonsmokers, and double daggers P<0.05 and section marks P<0.01 for the comparison with patients with COPD stage 0). In Panel C, P values for the comparison with healthy nonsmokers are shown above each bar. (The complete data and P values for all comparisons are given in Supplements 2 and 5 of the Supplementary Appendix.)
Levels of HDAC2 protein measured by Western blotting and normalizedto the lamin A/C proteins were also related to the clinicalstage of COPD. There was a graded reduction in HDAC2 expressionin samples from nonsmokers (1.60±0.16) and patients withstage 0 disease (1.10±0.13), stage 1 disease (0.750±0.077),and stage 2 disease (0.300±0.073), reaching a maximalreduction of 92 percent in the HDAC2 protein levels in samplesfrom patients with stage 4 disease (0.120±0.042; P=0.001for the comparison with nonsmokers and for the comparison withpatients with stage 0 disease) (Figure 2B and Figure 2C andSupplement 2 of the Supplementary Appendix). When normalizedaccording to DNA content instead of lamin A/C, HDAC2 expressionalso decreased with the increasing severity of COPD (in samplesfrom nonsmokers, 250±26 band density per microgram ofDNA; in those from patients with stage 0 disease, 173±26[P=0.06] for the comparison with nonsmokers; in those from patientswith stage 1 disease, 147±27 [P=0.04]; in those frompatients with stage 2 disease, 110±33 [P=0.004]; in thosefrom patients with stage 4 disease, 76±14 [P=0.001]),indicating that these changes cannot be explained by loss oflung tissue as a result of emphysema.
Alveolar Macrophages
Total HDAC activity in alveolar macrophages obtained with theuse of bronchoalveolar lavage from subjects who were smokers(5.90±0.58 µM) was slightly but not significantlydecreased, as compared with levels in samples from nonsmokers(7.40±0.69 µM). There was a significant reductionin HDAC activity in macrophages from patients with COPD stages2 and 3 (3.60±0.77 µM, P=0.01), as compared withactivity in those from nonsmokers (P=0.01), but not as comparedwith activity in those from healthy smokers (P=0.20) (Figure 3A).There was no evidence of a difference in total HAT activityin alveolar macrophages of patients with COPD as compared withnormal smokers and nonsmokers (P=0.33) (Figure 3A and Supplement6 of the Supplementary Appendix).
Figure 3. Histone Deacetylase (HDAC) and Histone Acetyltransferase (HAT) Activity in Alveolar Macrophages and Bronchial-Biopsy Specimens.
Panel A shows HDAC activity and HAT activity. Panel B shows expression of HDAC (HD) 1 through 8 mRNA in alveolar macrophages. Panel C shows HDAC activity. Panel D shows HAT activity in bronchial-biopsy specimens obtained from healthy nonsmokers, healthy smokers (those in group 1 are younger than those in group 2), and patients with COPD and those with mild asthma that had not previously been treated with steroids. The results are plotted as means ±SE, with the number of subjects in each group ranging from 6 to 14. In Panels A, C, and D, P values for the comparison with nonsmokers are shown above each bar. In Panel B, the significant differences are shown by the symbols above the bars (the asterisk indicates P<0.05 and the daggers P<0.01 for the comparison with nonsmokers). (The complete data and P values for all comparisons are given in Supplements 6, 7, and 8 of the Supplementary Appendix.)
HDAC2 mRNA expression was reduced in alveolar macrophages frompatients with COPD (0.00030±0.00016, corresponding to38 percent of the expression in samples from nonsmokers [0.00080±0.00016];P=0.01) but not in samples from healthy smokers (0.00050±0.00013,corresponding to 63 percent of the expression in samples fromnonsmokers; P=0.11) (Figure 3B). HDAC3 mRNA expression was alsosignificantly reduced in samples from healthy smokers (P=0.02)and those from patients with COPD (P=0.004), as compared withexpression in samples from nonsmokers (Figure 3B). Despite atendency toward lower levels of HDAC5 mRNA and HDAC8 mRNA, therewas no significant difference among all subject groups (accordingto the Kruskal–Wallis analysis of variance P=0.13 andP=0.67, respectively). (The complete data and P values are summarizedin Supplement 7 of the Supplementary Appendix.)
Bronchial Biopsies
To see whether the changes in HDAC activity and expression werespecific to COPD or reflected some process related to airwayobstruction, we compared HAT activity and HDAC activity in bronchial-biopsyspecimens from patients with COPD and from patients with asthma.Because the age of populations with asthma and those with COPDdiffer, we also studied healthy smokers who were matched forage with patients with asthma and those with COPD (Table 2).Total HDAC activity in biopsy specimens from patients with mildasthma (0.670±0.085 µM) and from age-matched healthysmokers (0.660±0.069 µM) showed a slight reductionas compared with activity in biopsy specimens from healthy nonsmokers(0.930±0.090 µM). Specimens from patients withCOPD (0.310±0.079 µM) and from age-matched smokers(0.570±0.083 µM) showed a significant further reductionin HDAC activity, as compared with activity in those from healthynonsmokers (0.930±0.089 µM) (Figure 3C). HDAC activityin specimens from patients with COPD was also significantlyless than in specimens from age-matched smokers (P=0.04) andfrom patients with asthma (P=0.01). There was no significantdifference (P=0.52) between HDAC activity in specimens fromyounger smokers (0.660±0.069 µM) and those fromolder smokers (0.570±0.083 µM). By contrast, specimensfrom patients with asthma showed a significant increase in HATactivity (27.4±3.0 µM, P=0.001), as compared withthose from nonsmokers (15.2±1.3 µM), whereas specimensfrom patients with COPD (17.4±3.8 µM) showed nochange in HAT activity (Figure 3D).
Discussion
Our data show that total HDAC activity is decreased in samplesof peripheral lung tissue, alveolar macrophages, and bronchial-biopsyspecimens from patients with COPD, as compared with activityin age-matched healthy nonsmokers. Increases in histone acetylationare usually associated with gene induction.6,7 The overall acetylationstatus of histones depends on the dynamic equilibrium betweenHAT activity and HDAC activity. Our current data show that interleukin-8mRNA and histone-4 acetylation at the NF-B binding site of theinterleukin-8 promoter were increased in samples of peripherallung tissue from patients with COPD. HDAC activity is decreased,despite little change in HAT activity, among these patients.There was a positive correlation between histone-4 acetylationand HDAC activity (P<0.001), indicating that the balancebetween HAT activity and HDAC activity is shifted toward histonehyperacetylation in the peripheral lung of patients with COPD.These changes may be relatively specific to COPD, because wecould not find a reduction in total HDAC activity in samplesfrom patients with asthma, cystic fibrosis, or pneumonia (Figure 1and Figure 3). In contrast, in asthma, which also involvesincreased expression of inflammatory genes in the respiratorytract, we confirmed previous observations14 showing increasedHAT activity in bronchial-biopsy specimens. Thus, in both asthmaand COPD, chromatin appears to be hyperacetylated but by meansof different mechanisms, and this increased histone acetylationprovides a mechanism for local unwinding of chromatin and asubsequent increase in inflammatory gene expression.6
In the present study, there was a positive correlation betweenHDAC activity and disease severity, as measured by the percentof predicted FEV1 or the degree of airway obstruction as measuredby the FEV1:FVC ratio. HDAC activity also correlated inverselywith expression of the interleukin-8 gene and associated histone-4acetylation in lung tissue. This finding suggests that the clinicalstage of COPD may be related to reduced HDAC activity, and thisreduced activity, in turn, could facilitate increased expressionof the relevant inflammatory genes.
There are 11 classic human HDACs that regulate histone acetylation.15We previously reported that HDAC2 is involved in suppressionof NF-B–mediated inflammatory gene expression by corticosteroids.7In the present study, we have shown that HDAC2 mRNA and proteinexpression is significantly reduced in tissue specimens of theperipheral lung and in alveolar macrophages from patients withCOPD. In addition, we have shown that HDAC3, 5, and 8 are alsoreduced in lung tissue and macrophages. These HDAC isoformsare reported to be involved in the cell cycle, cell differentiation,and apoptosis.15,16,17 Further experiments will be requiredto clarify how the reduced function of these HDACs influencesthe inflammatory process in COPD.
We speculate that our findings may have therapeutic implications,because reductions in HDAC activity may be reversible. Theophyllineis an activator of HDAC,13 and we have recently shown that lowconcentrations of theophylline completely restore HDAC activityin alveolar macrophages from patients with COPD, with reducedproduction of inflammatory cytokines and restoration of responsivenessto corticosteroids.18 Whether this is a mechanism of the therapeuticaction of theophylline in COPD is not known. We report thattotal HDAC activity and the expression of specific HDAC isoenzymesare decreased in peripheral lung tissue, bronchial-biopsy specimens,and alveolar macrophages of patients with COPD and that thisfinding is related to increasing disease severity. This findingcould in part account for the increased inflammatory responsein the respiratory tract of patients with COPD.
Supported by grants from the British Lung Foundation, AsthmaUK, the Clinical Research Committee (Royal Brompton Hospital),GlaxoSmithKline (United Kingdom), Boehringer Ingelheim, MitsubishiPharma, and the Canadian Institutes of Health Research (7246).
Dr. Ito reports having received research support from GlaxoSmithKline,Boehringer Ingelheim, and Pfizer; Dr. Adcock, research supportfrom Pfizer and AstraZeneca; Dr. Hogg, research support fromGlaxoSmithKline and AstraZeneca; and Dr. Barnes, research supportfrom GlaxoSmithKline, AstraZeneca, Boehringer Ingelheim, andMitsubishi Pharma — all companies that manufacture drugsused in the treatment of COPD. Dr. Ito reports having receivedlecture fees from Mitsubishi Pharma; Dr. Kon, lecture fees fromGlaxoSmithKline and AstraZeneca; Dr. Adcock, lecture fees fromGlaxoSmithKline; Dr. Hogg, lecture fees from GlaxoSmithKline,AstraZeneca, and Altana Pharma; and Dr. Barnes, lecture feesfrom GlaxoSmithKline, AstraZeneca, Boehringer Ingelheim, Pfizer,and Altana Pharma. In addition, Dr. Barnes reports having servedon advisory boards for GlaxoSmithKline, Boehringer Ingelheim,Pfizer, Novartis, and Altana Pharma.
We are indebted to Prof. Alberto Papi (University of Ferrara,Ferrara, Italy), Drs. Sergei A. Kharitonov and Yasuo To (NationalHeart and Lung Institute, London), Ms. F. Chu (University ofBritish Columbia, Vancouver, B.C., Canada), and Dr. ShunichiWatanabe (Royal Brompton Hospital, London) for assistance inproviding and preparing clinical samples.
Source Information
From the Airway Disease Section, National Heart and Lung Institute, Imperial College, London (K.I., M.I., B.C., O.M.K., I.M.A., P.J.B.); the Chest and Allergy Clinic, St. Mary's Hospital, London (O.M.K.); University of British Columbia and the James Hogg iCAPTURE Center for Cardiovascular and Pulmonary Research, St. Paul's Hospital, Vancouver, B.C., Canada (W.M.E., S.H., J.C.H.); the Department of Clinical and Experimental Medicine, Centro di Ricerca su Asma e Broncopneumopatia Cronica Ostruttiva, University of Ferrara, Ferrara, Italy (G.C.); and the Department of Pneumology, Silesian Medical Academy, Katowice, Poland (A.B.).
Address reprint requests to Dr. Barnes at the National Heart and Lung Institute, Imperial College, Dovehouse St., London SW3 6LY, United Kingdom, or at p.j.barnes{at}imperial.ac.uk.
References
Barnes PJ. Chronic obstructive pulmonary disease. N Engl J Med 2000;343:269-280. [Free Full Text]
Saetta M, Turato G, Maestrelli P, Mapp CE, Fabbri LM. Cellular and structural bases of chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2001;163:1304-1309. [Free Full Text]
Hogg JC, Chu F, Utokaparch S, et al. The nature of small-airway obstruction in chronic obstructive pulmonary disease. N Engl J Med 2004;350:2645-2653. [Free Full Text]
Keatings VM, Collins PD, Scott DM, Barnes PJ. Differences in interleukin-8 and tumor necrosis factor-alpha in induced sputum from patients with chronic obstructive pulmonary disease or asthma. Am J Respir Crit Care Med 1996;153:530-534. [Abstract]
Urnov FD, Wolffe AP. Chromatin remodeling and transcriptional activation: the cast (in order of appearance). Oncogene 2001;20:2991-3006. [CrossRef][Web of Science][Medline]
Ito K, Barnes PJ, Adcock IM. Glucocorticoid receptor recruitment of histone deacetylase 2 inhibits interleukin-1 beta-induced histone H4 acetylation on lysines 8 and 12. Mol Cell Biol 2000;20:6891-6903. [Free Full Text]
Barnes PJ, Ito K, Adcock IM. Corticosteroid resistance in chronic obstructive pulmonary disease: inactivation of histone deacetylase. Lancet 2004;363:731-733. [CrossRef][Web of Science][Medline]
Global Initiative for Chronic Obstructive Lung Disease (GOLD). Global strategy for the diagnosis, management and prevention of chronic obstructive pulmonary disease: NHLBI/WHO workshop report. Bethesda, Md.: National Heart, Lung, and Blood Institute, 2001. (NIH publication no. 2701.)
Ding L, Quinlan KB, Hamodat M, et al. A lung tissue bank for gene expression studies in chronic obstructive pulmonary disease. J COPD 2004;1:191-204.
Cosio BG, Mann B, Ito K, et al. Histone acetylase and deacetylase activity in alveolar macrophages and blood mononocytes in asthma. Am J Respir Crit Care Med 2004;170:141-147. [Free Full Text]
Ito K, Lim S, Caramori G, Chung KF, Barnes PJ, Adcock IM. Cigarette smoking reduces histone deacetylase 2 expression, enhances cytokine expression, and inhibits glucocorticoid actions in alveolar macrophages. FASEB J 2001;15:1110-1112. [Free Full Text]
Ito K, Lim S, Caramori G, et al. A molecular mechanism of action of theophylline: induction of histone deacetylase activity to decrease inflammatory gene expression. Proc Natl Acad Sci U S A 2002;99:8921-8926. [Free Full Text]
Ito K, Caramori G, Lim S, et al. Expression and activity of histone deacetylases in human asthmatic airways. Am J Respir Crit Care Med 2002;166:392-396. [Free Full Text]
de Ruijter AJ, van Gennip AH, Caron HN, Kemp S, van Kuilenburg AB. Histone deacetylases (HDACs): characterization of the classical HDAC family. Biochem J 2003;370:737-749. [CrossRef][Web of Science][Medline]
Durst KL, Lutterbach B, Kummalue T, Friedman AD, Hiebert SW. The inv(16) fusion protein associates with corepressors via a smooth muscle myosin heavy-chain domain. Mol Cell Biol 2003;23:607-619. [Free Full Text]
Bertos NR, Wang AH, Yang XJ. Class II histone deacetylases: structure, function, and regulation. Biochem Cell Biol 2001;79:243-252. [CrossRef][Web of Science][Medline]
Cosio BG, Tsaprouni L, Ito K, Jazrawi E, Adcock IM, Barnes PJ. Theophylline restores histone deacetylase activity and steroid responses in COPD macrophages. J Exp Med 2004;200:689-695. [Free Full Text]
Lapperre, T. S., Snoeck-Stroband, J. B., Gosman, M. M.E., Jansen, D. F., van Schadewijk, A., Thiadens, H. A., Vonk, J. M., Boezen, H. M., ten Hacken, N. H.T., Sont, J. K., Rabe, K. F., Kerstjens, H. A.M., Hiemstra, P. S., Timens, W., Postma, D. S., Sterk, P. J., the GLUCOLD (Groningen Leiden Universities Cortico,
(2009). Effect of Fluticasone With and Without Salmeterol on Pulmonary Outcomes in Chronic Obstructive Pulmonary Disease: A Randomized Trial. ANN INTERN MED
151: 517-527
[Abstract][Full Text]
Barnes, P. J.
(2009). Histone deacetylase-2 and airway disease. Ther Adv Respir Dis
3: 235-243
[Abstract]
MacNee, W., Tuder, R. M.
(2009). New Paradigms in the Pathogenesis of Chronic Obstructive Pulmonary Disease I. Proc Am Thorac Soc
6: 527-531
[Abstract][Full Text]
Bourbeau, J., Johnson, M.
(2009). New and Controversial Therapies for Chronic Obstructive Pulmonary Disease. Proc Am Thorac Soc
6: 553-554
[Abstract][Full Text]
Wan, E. S., Silverman, E. K.
(2009). Genetics of COPD and Emphysema. Chest
136: 859-866
[Abstract][Full Text]
Nakamaru, Y., Vuppusetty, C., Wada, H., Milne, J. C., Ito, M., Rossios, C., Elliot, M., Hogg, J., Kharitonov, S., Goto, H., Bemis, J. E., Elliott, P., Barnes, P. J., Ito, K.
(2009). A protein deacetylase SIRT1 is a negative regulator of metalloproteinase-9. FASEB J.
23: 2810-2819
[Abstract][Full Text]
Noh, H., Oh, E. Y., Seo, J. Y., Yu, M. R., Kim, Y. O., Ha, H., Lee, H. B.
(2009). Histone deacetylase-2 is a key regulator of diabetes- and transforming growth factor-{beta}1-induced renal injury. Am. J. Physiol. Renal Physiol.
297: F729-F739
[Abstract][Full Text]
Suissa, S., Barnes, P. J.
(2009). Inhaled corticosteroids in COPD: the case against. Eur Respir J
34: 13-16
[Full Text]
Bartling, T. R., Drumm, M. L.
(2009). Loss of CFTR results in reduction of histone deacetylase 2 in airway epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol.
297: L35-L43
[Abstract][Full Text]
Cosio, M. G., Saetta, M., Agusti, A.
(2009). Immunologic Aspects of Chronic Obstructive Pulmonary Disease. NEJM
360: 2445-2454
[Full Text]
Osoata, G. O., Hanazawa, T., Brindicci, C., Ito, M., Barnes, P. J., Kharitonov, S., Ito, K.
(2009). Peroxynitrite Elevation in Exhaled Breath Condensate of COPD and Its Inhibition by Fudosteine. Chest
135: 1513-1520
[Abstract][Full Text]
Cosio, B G, Iglesias, A, Rios, A, Noguera, A, Sala, E, Ito, K, Barnes, P J, Agusti, A
(2009). Low-dose theophylline enhances the anti-inflammatory effects of steroids during exacerbations of COPD. Thorax
64: 424-429
[Abstract][Full Text]
Gaschler, G. J., Skrtic, M., Zavitz, C. C. J., Lindahl, M., Onnervik, P.-O., Murphy, T. F., Sethi, S., Stampfli, M. R.
(2009). Bacteria Challenge in Smoke-exposed Mice Exacerbates Inflammation and Skews the Inflammatory Profile. Am. J. Respir. Crit. Care Med.
179: 666-675
[Abstract][Full Text]
Adenuga, D., Yao, H., March, T. H., Seagrave, J., Rahman, I.
(2009). Histone Deacetylase 2 Is Phosphorylated, Ubiquitinated, and Degraded by Cigarette Smoke. Am. J. Respir. Cell Mol. Bio.
40: 464-473
[Abstract][Full Text]
Marwick, J. A., Caramori, G., Stevenson, C. S., Casolari, P., Jazrawi, E., Barnes, P. J., Ito, K., Adcock, I. M., Kirkham, P. A., Papi, A.
(2009). Inhibition of PI3K{delta} Restores Glucocorticoid Function in Smoking-induced Airway Inflammation in Mice. Am. J. Respir. Crit. Care Med.
179: 542-548
[Abstract][Full Text]
Suzuki, M., Betsuyaku, T., Ito, Y., Nagai, K., Odajima, N., Moriyama, C., Nasuhara, Y., Nishimura, M.
(2009). Curcumin attenuates elastase- and cigarette smoke-induced pulmonary emphysema in mice. Am. J. Physiol. Lung Cell. Mol. Physiol.
296: L614-L623
[Abstract][Full Text]
Bhattacharya, S., Srisuma, S., DeMeo, D. L., Shapiro, S. D., Bueno, R., Silverman, E. K., Reilly, J. J., Mariani, T. J.
(2009). Molecular Biomarkers for Quantitative and Discrete COPD Phenotypes. Am. J. Respir. Cell Mol. Bio.
40: 359-367
[Abstract][Full Text]
Singh, S., Amin, A. V., Loke, Y. K.
(2009). Long-term Use of Inhaled Corticosteroids and the Risk of Pneumonia in Chronic Obstructive Pulmonary Disease: A Meta-analysis. Arch Intern Med
169: 219-229
[Abstract][Full Text]
Yang, S.-R., Yao, H., Rajendrasozhan, S., Chung, S., Edirisinghe, I., Valvo, S., Fromm, G., McCabe, M. J. Jr., Sime, P. J., Phipps, R. P., Li, J.-D., Bulger, M., Rahman, I.
(2009). RelB Is Differentially Regulated by I{kappa}B Kinase-{alpha} in B Cells and Mouse Lung by Cigarette Smoke. Am. J. Respir. Cell Mol. Bio.
40: 147-158
[Abstract][Full Text]
Ito, K., Barnes, P. J.
(2009). COPD as a Disease of Accelerated Lung Aging. Chest
135: 173-180
[Abstract][Full Text]
Marik, P. E.
(2009). Critical Illness-Related Corticosteroid Insufficiency. Chest
135: 181-193
[Abstract][Full Text]
Bartling, T. R., Drumm, M. L.
(2009). Oxidative Stress Causes IL8 Promoter Hyperacetylation in Cystic Fibrosis Airway Cell Models. Am. J. Respir. Cell Mol. Bio.
40: 58-65
[Abstract][Full Text]
Rahman, I.
(2008). Review: Antioxidant therapeutic advances in COPD. Ther Adv Respir Dis
2: 351-374
[Abstract]
Ito, K., Herbert, C., Siegle, J. S., Vuppusetty, C., Hansbro, N., Thomas, P. S., Foster, P. S., Barnes, P. J., Kumar, R. K.
(2008). Steroid-Resistant Neutrophilic Inflammation in a Mouse Model of an Acute Exacerbation of Asthma. Am. J. Respir. Cell Mol. Bio.
39: 543-550
[Abstract][Full Text]
Seemungal, T., Sykes, A., and the ICEAD Contributors,
(2008). Recent advances in exacerbations of COPD. Thorax
63: 850-852
[Full Text]
Meja, K. K., Rajendrasozhan, S., Adenuga, D., Biswas, S. K., Sundar, I. K., Spooner, G., Marwick, J. A., Chakravarty, P., Fletcher, D., Whittaker, P., Megson, I. L., Kirkham, P. A., Rahman, I.
(2008). Curcumin Restores Corticosteroid Function in Monocytes Exposed to Oxidants by Maintaining HDAC2. Am. J. Respir. Cell Mol. Bio.
39: 312-323
[Abstract][Full Text]
Adcock, I. M., Barnes, P. J.
(2008). Molecular Mechanisms of Corticosteroid Resistance. Chest
134: 394-401
[Abstract][Full Text]
Marumo, T., Hishikawa, K., Yoshikawa, M., Fujita, T.
(2008). Epigenetic Regulation of BMP7 in the Regenerative Response to Ischemia. J. Am. Soc. Nephrol.
19: 1311-1320
[Abstract][Full Text]
Chung, K. F., Adcock, I. M.
(2008). Multifaceted mechanisms in COPD: inflammation, immunity, and tissue repair and destruction. Eur Respir J
31: 1334-1356
[Abstract][Full Text]
Yang, S.-R., Valvo, S., Yao, H., Kode, A., Rajendrasozhan, S., Edirisinghe, I., Caito, S., Adenuga, D., Henry, R., Fromm, G., Maggirwar, S., Li, J.-D., Bulger, M., Rahman, I.
(2008). IKK{alpha} Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung. Am. J. Respir. Cell Mol. Bio.
38: 689-698
[Abstract][Full Text]
Yao, H., Edirisinghe, I., Rajendrasozhan, S., Yang, S.-R., Caito, S., Adenuga, D., Rahman, I.
(2008). Cigarette smoke-mediated inflammatory and oxidative responses are strain-dependent in mice. Am. J. Physiol. Lung Cell. Mol. Physiol.
294: L1174-L1186
[Abstract][Full Text]
Falk, J. A., Minai, O. A., Mosenifar, Z.
(2008). Inhaled and Systemic Corticosteroids in Chronic Obstructive Pulmonary Disease. Proc Am Thorac Soc
5: 506-512
[Abstract][Full Text]
Lee, C.-W., Lin, C.-C., Luo, S.-F., Lee, H.-C., Lee, I.-T., Aird, W. C., Hwang, T.-L., Yang, C.-M.
(2008). Tumor Necrosis Factor-{alpha} Enhances Neutrophil Adhesiveness: Induction of Vascular Cell Adhesion Molecule-1 via Activation of Akt and CaM Kinase II and Modifications of Histone Acetyltransferase and Histone Deacetylase 4 in Human Tracheal Smooth Muscle Cells. Mol. Pharmacol.
73: 1454-1464
[Abstract][Full Text]
Rajendrasozhan, S., Yang, S.-R., Kinnula, V. L., Rahman, I.
(2008). SIRT1, an Antiinflammatory and Antiaging Protein, Is Decreased in Lungs of Patients with Chronic Obstructive Pulmonary Disease. Am. J. Respir. Crit. Care Med.
177: 861-870
[Abstract][Full Text]
Churg, A., Cosio, M., Wright, J. L.
(2008). Mechanisms of cigarette smoke-induced COPD: insights from animal models. Am. J. Physiol. Lung Cell. Mol. Physiol.
294: L612-L631
[Abstract][Full Text]
Dahl, J. A., Collas, P.
(2008). {micro}ChIP--a rapid micro chromatin immunoprecipitation assay for small cell samples and biopsies. Nucleic Acids Res
36: e15-e15
[Abstract][Full Text]
Renda, T., Baraldo, S., Pelaia, G., Bazzan, E., Turato, G., Papi, A., Maestrelli, P., Maselli, R., Vatrella, A., Fabbri, L. M., Zuin, R., Marsico, S. A., Saetta, M.
(2008). Increased activation of p38 MAPK in COPD. Eur Respir J
31: 62-69
[Abstract][Full Text]
Dombrowsky, H., Uhlig, S.
(2007). Steroids and histone deacetylase in ventilation-induced gene transcription. Eur Respir J
30: 865-877
[Abstract][Full Text]
Stevenson, C. S., Docx, C., Webster, R., Battram, C., Hynx, D., Giddings, J., Cooper, P. R., Chakravarty, P., Rahman, I., Marwick, J. A., Kirkham, P. A., Charman, C., Richardson, D. L., Nirmala, N. R., Whittaker, P., Butler, K.
(2007). Comprehensive gene expression profiling of rat lung reveals distinct acute and chronic responses to cigarette smoke inhalation. Am. J. Physiol. Lung Cell. Mol. Physiol.
293: L1183-L1193
[Abstract][Full Text]
Suissa, S., McGhan, R., Niewoehner, D., Make, B.
(2007). Inhaled Corticosteroids in Chronic Obstructive Pulmonary Disease. Proc Am Thorac Soc
4: 535-542
[Abstract][Full Text]
Chang, J., Mosenifar, Z.
(2007). Differentiating COPD From Asthma in Clinical Practice. J Intensive Care Med
22: 300-309
[Abstract]
Li, L.-b., Leung, D. Y. M., Strand, M. J., Goleva, E.
(2007). ATF2 impairs glucocorticoid receptor mediated transactivation in human CD8+ T cells. Blood
110: 1570-1577
[Abstract][Full Text]
James, A. L., Wenzel, S.
(2007). Clinical relevance of airway remodelling in airway diseases. Eur Respir J
30: 134-155
[Abstract][Full Text]
Yoshida, T., Tuder, R. M.
(2007). Pathobiology of Cigarette Smoke-Induced Chronic Obstructive Pulmonary Disease. Physiol. Rev.
87: 1047-1082
[Abstract][Full Text]
Celli, B. R., Barnes, P. J.
(2007). Exacerbations of chronic obstructive pulmonary disease. Eur Respir J
29: 1224-1238
[Abstract][Full Text]
Ito, K., Caramori, G., Adcock, I. M.
(2007). Therapeutic Potential of Phosphatidylinositol 3-Kinase Inhibitors in Inflammatory Respiratory Disease. J. Pharmacol. Exp. Ther.
321: 1-8
[Abstract][Full Text]
Sutherland, E. R.
(2007). Inhaled Steroids and Outcomes in COPD: Progressing Beyond FEV1. Chest
131: 648-649
[Full Text]
Livingston, E., Chaudhuri, R., McMahon, A. D., Fraser, I., McSharry, C. P., Thomson, N. C.
(2007). Systemic sensitivity to corticosteroids in smokers with asthma. Eur Respir J
29: 64-71
[Abstract][Full Text]
Maeda, Y., Dave, V., Whitsett, J. A.
(2007). Transcriptional Control of Lung Morphogenesis. Physiol. Rev.
87: 219-244
[Abstract][Full Text]
Yoshikawa, M., Hishikawa, K., Marumo, T., Fujita, T.
(2007). Inhibition of Histone Deacetylase Activity Suppresses Epithelial-to-Mesenchymal Transition Induced by TGF-beta1 in Human Renal Epithelial Cells. J. Am. Soc. Nephrol.
18: 58-65
[Abstract][Full Text]
Barnes, P J
(2006). Theophylline for COPD. Thorax
61: 742-743
[Full Text]
Hirano, T, Yamagata, T, Gohda, M, Yamagata, Y, Ichikawa, T, Yanagisawa, S, Ueshima, K, Akamatsu, K, Nakanishi, M, Matsunaga, K, Minakata, Y, Ichinose, M
(2006). Inhibition of reactive nitrogen species production in COPD airways: comparison of inhaled corticosteroid and oral theophylline. Thorax
61: 761-766
[Abstract][Full Text]
Cookson, W. O. C.
(2006). State of the Art. Genetics and Genomics of Chronic Obstructive Pulmonary Disease. Proc Am Thorac Soc
3: 473-475
[Full Text]
Tuder, R. M., Yoshida, T., Arap, W., Pasqualini, R., Petrache, I.
(2006). State of the Art. Cellular and Molecular Mechanisms of Alveolar Destruction in Emphysema: An Evolutionary Perspective. Proc Am Thorac Soc
3: 503-510
[Abstract][Full Text]
Barnes, P. J.
(2006). Against the dutch hypothesis: asthma and chronic obstructive pulmonary disease are distinct diseases.. Am. J. Respir. Crit. Care Med.
174: 240-243
[Full Text]
Yin, Z., Gonzales, L., Kolla, V., Rath, N., Zhang, Y., Lu, M. M., Kimura, S., Ballard, P. L., Beers, M. F., Epstein, J. A., Morrisey, E. E.
(2006). Hop functions downstream of Nkx2.1 and GATA6 to mediate HDAC-dependent negative regulation of pulmonary gene expression. Am. J. Physiol. Lung Cell. Mol. Physiol.
291: L191-L199
[Abstract][Full Text]
Barnes, P. J., Chowdhury, B., Kharitonov, S. A., Magnussen, H., Page, C. P., Postma, D., Saetta, M.
(2006). Pulmonary Biomarkers in Chronic Obstructive Pulmonary Disease. Am. J. Respir. Crit. Care Med.
174: 6-14
[Abstract][Full Text]
Szulakowski, P., Crowther, A. J. L., Jimenez, L. A., Donaldson, K., Mayer, R., Leonard, T. B., MacNee, W., Drost, E. M.
(2006). The Effect of Smoking on the Transcriptional Regulation of Lung Inflammation in Patients with Chronic Obstructive Pulmonary Disease. Am. J. Respir. Crit. Care Med.
174: 41-50
[Abstract][Full Text]
Berenson, C. S., Wrona, C. T., Grove, L. J., Maloney, J., Garlipp, M. A., Wallace, P. K., Stewart, C. C., Sethi, S.
(2006). Impaired Alveolar Macrophage Response to Haemophilus Antigens in Chronic Obstructive Lung Disease. Am. J. Respir. Crit. Care Med.
174: 31-40
[Abstract][Full Text]
Yang, S.-R., Chida, A. S., Bauter, M. R., Shafiq, N., Seweryniak, K., Maggirwar, S. B., Kilty, I., Rahman, I.
(2006). Cigarette smoke induces proinflammatory cytokine release by activation of NF-{kappa}B and posttranslational modifications of histone deacetylase in macrophages. Am. J. Physiol. Lung Cell. Mol. Physiol.
291: L46-L57
[Abstract][Full Text]
Fabbri, L. M., Luppi, F., Beghe, B., Rabe, K. F.
(2006). Update in chronic obstructive pulmonary disease 2005.. Am. J. Respir. Crit. Care Med.
173: 1056-1065
[Full Text]
Anderson, G. P.
(2006). COPD, asthma and C-reactive protein.. Eur Respir J
27: 874-876
[Full Text]
Slevogt, H., Schmeck, B., Jonatat, C., Zahlten, J., Beermann, W., van Laak, V., Opitz, B., Dietel, S., N'Guessan, P. D., Hippenstiel, S., Suttorp, N., Seybold, J.
(2006). Moraxella catarrhalis induces inflammatory response of bronchial epithelial cells via MAPK and NF-{kappa}B activation and histone deacetylase activity reduction. Am. J. Physiol. Lung Cell. Mol. Physiol.
290: L818-L826
[Abstract][Full Text]
Xu, Y., Sengupta, P. K., Seto, E., Smith, B. D.
(2006). Regulatory Factor for X-box Family Proteins Differentially Interact with Histone Deacetylases to Repress Collagen {alpha}2(I) Gene (COL1A2) Expression. J. Biol. Chem.
281: 9260-9270
[Abstract][Full Text]
Schottenfeld, D., Beebe-Dimmer, J.
(2006). Chronic inflammation: a common and important factor in the pathogenesis of neoplasia.. CA Cancer J Clin
56: 69-83
[Abstract][Full Text]
KIM, J.-S., SHUKLA, S. D.
(2006). ACUTE IN VIVO EFFECT OF ETHANOL (BINGE DRINKING) ON HISTONE H3 MODIFICATIONS IN RAT TISSUES. Alcohol Alcohol
41: 126-132
[Abstract][Full Text]
Ito, K., Yamamura, S., Essilfie-Quaye, S., Cosio, B., Ito, M., Barnes, P. J., Adcock, I. M.
(2006). Histone deacetylase 2-mediated deacetylation of the glucocorticoid receptor enables NF-{kappa}B suppression. JEM
203: 7-13
[Abstract][Full Text]
Barnes, P. J.
(2006). Reduced Histone Deacetylase in COPD: Clinical Implications. Chest
129: 151-155
[Abstract][Full Text]
Chung, K. F.
(2005). The Role of Airway Smooth Muscle in the Pathogenesis of Airway Wall Remodeling in Chronic Obstructive Pulmonary Disease. Proc Am Thorac Soc
2: 347-354
[Abstract][Full Text]
Houslay, M. D.
(2005). The Long and Short of Vascular Smooth Muscle Phosphodiesterase-4 As a Putative Therapeutic Target. Mol. Pharmacol.
68: 563-567
[Abstract][Full Text]
Lin, A. Y., Bhowmik, A., Barnes, P. J., Adcock, I. M., Ito, K.
(2005). Histone Deacetylase Activity and COPD. NEJM
353: 528-529
[Full Text]
Nachman, S A
(2005). Severity of COPD is linked to decreased histone deacetylase activity. Thorax
60: 594-594
[Full Text]
Shapiro, S. D.
(2005). COPD Unwound. NEJM
352: 2016-2019
[Full Text]
A correction has been published: N Engl J Med 2005;353(5):528.
, are increased in the sputum of patients with COPD, as compared with that of normal subjects.5 Histone acetyltransferase (HAT) and histone deacetylase (HDAC) are families of nuclear enzymes that modify the expression of inflammatory genes by regulating chromatin structure.6 Acetylation of the core histones by transcriptional coactivator proteins, which possess intrinsic HAT activity, leads to changes in the chromatin structure that subsequently allow the transcription factors and RNA polymerase II to bind to DNA and enhance gene transcription. Conversely, deacetylation of the core histones is generally associated with the repression of transcription. 
B (NF-
Previous
