Background Nucleophosmin (NPM), a nucleocytoplasmic shuttlingprotein with prominent nucleolar localization, regulates theARF-p53 tumor-suppressor pathway. Translocations involving theNPM gene cause cytoplasmic dislocation of the NPM protein.
Methods We used immunohistochemical methods to study the subcellularlocalization of NPM in bone marrow–biopsy specimens from591 patients with primary acute myelogenous leukemia (AML).We then correlated the presence of cytoplasmic NPM with clinicaland biologic features of the disease.
Results Cytoplasmic NPM was detected in 208 (35.2 percent) ofthe 591 specimens from patients with primary AML but not in135 secondary AML specimens or in 980 hematopoietic or extrahematopoieticneoplasms other than AML. It was associated with a wide spectrumof morphologic subtypes of the disease, a normal karyotype,and responsiveness to induction chemotherapy, but not with recurrentgenetic abnormalities. There was a high frequency of FLT3 internaltandem duplications and absence of CD34 and CD133 in AML specimenswith a normal karyotype and cytoplasmic dislocation of NPM,but not in those in which the protein was restricted to thenucleus. AML specimens with cytoplasmic NPM carried mutationsof the NPM gene that were predicted to alter the protein atits C-terminal; this mutant gene caused cytoplasmic localizationof NPM in transfected cells.
Conclusions Cytoplasmic NPM is a characteristic feature of alarge subgroup of patients with AML who have a normal karyotype,NPM gene mutations, and responsiveness to induction chemotherapy.
Acute myelogenous leukemia (AML), the most common form of acuteleukemia in adults, is a heterogeneous group of diseases thatare curable in about 30 percent of cases. Cytogenetic analysisassigns AML to different prognostic groups1; some subtypes,such as acute promyelocytic leukemia with a t(15;17) translocation(subtype M3 according to the French–American–British[FAB] classification), are amenable to specific therapies. However,no chromosomal abnormality is visible by conventional karyotypingin 40 to 50 percent of cases. Attempts to stratify such caseson the basis of microarrays of complementary DNA2,3 have succeededin associating gene-expression patterns with differences inresponses to treatment, but no specific genetic subgroups haveemerged from these studies.
Nucleophosmin (NPM), a protein that shuttles between the nucleusand cytoplasm,4 is most prominent in nucleoli.5 NPM is a molecularchaperone6 that may prevent protein aggregation in the nucleolusand regulate the assembly and transport of preribosomal particlesthrough the nuclear membrane.4 It is also a target of CDK2–cyclinE complexes in centrosome duplication7 and has been implicatedin the regulation of the alternate-reading-frame protein (ARF)–p53tumor-suppressor pathway.8,9,10
The NPM gene is a partner in the chromosomal translocationsof leukemias and lymphomas that result in fusion proteins containingonly the NPM N-terminal region11,12 — namely, NPM–anaplasticlymphoma kinase (NPM-ALK),13 NPM–retinoic acid receptor (NPM-RAR),14 and NPM–myeloid leukemia factor 1 (NPM-MLF1).15NPM appears to contribute to oncogenesis by activating the oncogenicpotential of the fused protein partner (ALK, MLF1, or RAR).16Since NPM is thought to have a tumor-suppressor function, perturbationsin its movement from the nucleus to the cytoplasm may be criticalfor malignant transformation. Such changes in the subcellulardistribution of NPM and NPM-containing fusion protein can bedetected by immunohistochemical methods.12,17
In this study, we identified a large subgroup of patients withAML who had cytoplasmic NPM in leukemic blasts, a mutated NPMgene, a normal karyotype, and a relatively good response toinduction chemotherapy.
Methods
Tumor Samples
Immunohistochemical studies were performed on 1835 paraffin-embeddedtumor specimens from the following patients: 591 patients (15to 60 years of age) with primary AML other than FAB subtypeM3 who had been enrolled in Italy either in the Gruppo ItalianoMalattie Ematologiche dell'Adulto (GIMEMA) Leucemia Acuta MieloideProtocollo begun in 1999 (LAM99P) (316 patients), or in theGIMEMA/European Organization for Research and Treatment of Cancer(GIMEMA/EORTC) AML12 trials (275 patients) (details availablefrom the National Auxiliary Publications Service []); 129 patientswith primary AML (including 70 with FAB subtype M3), and 135with secondary AML who had not been participants in the GIMEMAstudy (details available from ); and 980 with hematopoieticand extrahematopoietic neoplasms other than AML. Specimens from25 patients with AML were investigated by immunohistochemistry,both at diagnosis and at remission.
After written informed consent had been obtained at each participatingcenter, a bone marrow–biopsy specimen from each patientwas fixed for 2.5 hours in B5, transferred to a 70 percent alcoholsolution, and delivered to the Institute of Hematology at theUniversity of Perugia, Perugia, Italy. The specimens were decalcifiedand processed for paraffin embedment.
Antibodies
Immunohistochemical studies were performed with the use of monoclonalantibodies against ALK and NPM,5,11,12 including two new anti-NPMmonoclonal antibodies (clones 322 and 376) that produce strongstaining in paraffin sections. Other monoclonal antibodies usedwere antinucleolin (anti-C23) (Santa Cruz Biotechnology), antiglycophorin,anti-CD34 (DakoCytomation), and anti-CD133 (Miltenyi Biotec).
Immunohistochemical Staining
Immunostaining was performed with use of the alkaline phosphatasemonoclonal anti–alkaline phosphatase technique18 (detailsavailable from ). The subcellular distribution of NPM (i.e.,restriction to the nucleus or presence in the cytoplasm) wasassessed without knowledge of the FAB subtype, cytogenetic features,or molecular findings. Cases were classified as either NPMc+(positive for cytoplasmic NPM) or NPMc– (negative forcytoplasmic NPM). All sections were stained in parallel fornucleolin (C23), another nucleolar antigen, which in NPMc+ caseswas required to be restricted to the nucleus.
Cytogenetic and Molecular Analyses
Cytogenetic investigations were performed after short-term culture.Karyotypes, analyzed after G-banding, were described accordingto the International System for Human Cytogenetic Nomenclature.19Fluorescence in situ hybridization (FISH) investigations werecarried out as previously described.20 The following analyseswere also carried out as previously described: reverse-transcriptase–polymerase-chain-reaction(RT-PCR) analysis for promyelocytic leukemia (PML)–RAR,acute myelogenous leukemia 1–eight twenty-one (AML1-ETO),core binding factor B–myosin heavy chain 11 (CBFB-MYH11),breakpoint cluster region–v-Abl Abelson murine leukemiaviral oncogene homologue 1 (BCR-ABL), and DEK–nucleoporin214 kD (DEK-CAN); Southern blotting and FISH for rearrangementsin the mixed-lineage leukemia gene (MLL); and mutational analysisof the Fms-like tyrosine kinase gene (FLT3) and MLL.21,22,23,24
Mutational Analysis of NPM
We investigated 161 specimens for NPM mutations: 52 specimensof NPMc+ AML, 56 of NPMc– AML, 9 of chronic myelogenousleukemia, and 44 of lymphoid neoplasms (Table 1). Specimensfrom five patients with NPMc+ AML were analyzed both at diagnosisand at remission.
Table 1.NPM Mutations in 161 Specimens of Myelogenous Leukemias and Lymphoid Neoplasms.
For the NPM coding-region analysis, 1 µg of RNA was retrotranscribedwith use of the Thermoscript RT-PCR System (Invitrogen). ThencDNA sequences were amplified with primers NPM1_25F (5'GGTTGTTCTCTGGAGCAGCGTTC3')and NPM1_1112R (5'CCTGGACAACATTTATCAAACACGGTA3') with use ofthe Expand High-FidelityPLUS PCR System (Roche Applied Science).To amplify the sequence of NPM1 exon 12 from genomic DNA, twooligonucleotides were designed to anneal to the flanking intronsequences (NPM1-F [5'TTAACTCTCTGGTGGTAGAATGAA3'] and NPM1-R[5'CAAGACTATTTGCCATTCCTAAC3']). PCR products, purified by standardmethods, were sequenced directly from both strands. Mutationswere confirmed by assessing independent PCR products and, inrepresentative cases, by cloning with pGEM-T Easy Vector Systems(Promega) and sequencing.
Expression Vectors and Transfection Assays
Antihuman NPM monoclonal antibodies also react with NPM fromother species (including mouse). To track the localization ofexogenous NPM, we generated plasmids expressing wild-type (pEGFPc1-NPMwt)or mutant (pEGFPc1-NPMmA) NPM alleles fused to the enhancedgreen fluorescent protein (EGFP). NPM cDNA sequences in an NPMc+AML specimen from a patient carrying a heterozygous mutationin exon 12 were amplified with the use of primers NPM1_89F_BamHI(GCCACGGATCCGAAGATTCGATGGAC) and NPM1_ 1044R_EcoRI (ATCAAGAATTCCAGAAATGAAATAAGACG)and subcloned in frame into the pEGFPc1 vector (BD BiosciencesClontech). Sequencing analysis confirmed that there were noTaq-introduced errors in either plasmid.
NIH-3T3 cells were transiently transfected with pEGFPc1-NPMwt,pEGFPc1-NPMmA, and empty pEGFPc1 vector with the use of Lipofectamine2000 reagents (Invitrogen). Transfection efficiency was monitoredby Western blotting. Images were obtained with a confocal microscope(Bio-Rad MRC-1024), with the use of Imaris software for three-dimensionalreconstruction.
Statistical Analysis
Chi-square analysis with two-way contingency tables was usedto test the association between categorical variables. Statisticaldifferences between means were analyzed by the t-test. A multivariatelogistic model was used to analyze associations among the white-cellcount at presentation, subcellular NPM localization, FLT3 mutations,and the response to induction therapy in 126 assessable patientswith AML and a normal karyotype (79 NPMc+ and 47 NPMc–)who were treated according to the GIMEMA LAM99P protocol (induction,consolidation, and postconsolidation therapy [as described inSupplementary Appendix 1A, available with the full text of thisarticle at www.nejm.org]). Analyses were performed with SASsoftware (version 8.2). Two-sided P values of less than 0.05were considered to indicate statistical significance.
Results
Cytoplasmic Dislocation of NPM
Of the 591 specimens from patients with AML in the GIMEMA LAM99Pand GIMEMA/EORTC AML12 trials, 208 (35.2 percent) were NPMc+(Figure 1A and Figure 1B). All the other tumors were NPMc–(Figure 1B). In NPMc+ leukemic cells, nucleolin (C23) remainedrestricted to the nucleus (Figure 1A). Cytoplasmic NPM was usuallyfound in all leukemic cells, except in FAB subtype M5b (monocyticleukemia) specimens, where it was detected in 30 to 60 percentof the most immature cells of monocytic lineage (data not shown).NPMc– AML specimens contained only a few NPMc+ leukemiccells, usually tumor cells undergoing mitosis (Figure 1A).
Figure 1. Specific Association of Cytoplasmic Expression of Nucleophosmin with a Large Subgroup of AML.
Panel A shows subcellular patterns of expression of nucleophosmin (NPM) in specimens from patients with acute myelogenous leukemia (AML) (alkaline phosphatase monoclonal anti–alkaline phosphatase [APAAP] technique). In NPMc+ AML (two left-hand images), most leukemic cells (arrow) show cytoplasmic NPM expression in addition to nuclear NPM expression; the arrowhead indicates a residual hematopoietic cell with the expected pattern of nucleus-restricted NPM. In NPMc+ AML, C23 is always restricted to the nucleus. In the two right-hand images, leukemic cells that are negative for cytoplasmic NPM (NPMc–) have the expected nuclear expression of NPM and nucleolin (C23); the arrows indicate mitotic figures with the expected cytoplasmic expression of NPM and C23. Panel B presents data, based on the subcellular expression of NPM in paraffin sections from 1706 human tumors, indicating that cytoplasmic expression of NPM is specific to primary AML. Cytoplasmic expression of NPM was restricted to 35.2 percent of the specimens from patients with primary AML who were enrolled in the GIMEMA LAM99P and GIMEMA/EORTC AML12 trials. (One hundred twenty-nine patients with primary AML not enrolled in the GIMEMA/EORTC studies were excluded from this analysis.) All the other specimens, including those from 135 patients with secondary AML, showed nucleus-restricted NPM expression. ALL denotes acute lymphoid leukemia, CML chronic myelogenous leukemia, MDS myelodysplastic syndrome, and NHL non-Hodgkin's lymphoma. As indicated by the data in Panel C, NPMc+ AML represents a wide morphologic spectrum of French–American–British (FAB) subtypes. The graph shows the correlation between subcellular NPM expression and morphologic subtype in specimens from 591 patients with primary AML in the GIMEMA/EORTC study plus 70 patients with AML of the M3 subtype with a t(15;17) translocation who were not enrolled in the trial. Panel D shows NPMc+ AML specimens of the M6 subtype with cytoplasmic NPM expression in erythroid and myeloid cell lineages (APAAP technique). In the left-hand image, the marrow is infiltrated by myeloid blasts (arrowhead) and erythroid blasts (arrow). In the middle image, abnormal erythroid precursors (arrow) and clusters of myeloid blasts (double arrow) show cytoplasmic as well as nuclear NPM expression; the arrowhead indicates a residual hematopoietic cell with nucleus-restricted NPM expression, and the arrow in the inset indicates double-staining of leukemic cells for surface glycophorin (brown) and cytoplasmic and nuclear NPM (blue). In the right-hand image, leukemic cells show nucleus-restricted nucleolin (C23) expression; the arrow in the inset indicates double-staining of leukemic cells for surface glycophorin (brown) and nucleus-restricted C23 (blue).
The NPMc+ pattern was found at diagnosis and in relapse in the25 patients studied at those times. The NPMc+ pattern also wasseen only in those with primary AML; specimens from the 135patients with secondary AML contained NPM restricted exclusivelyto the nucleus (Figure 1B).
Features of NPMc+ AML
Morphology
The NPMc+ pattern was found in AML specimens of all FAB subtypesexcept M3 (acute promyelocytic leukemia), M4eo (acute myelomonocyticleukemia with eosinophilia), and M7 (acute megakaryocytic leukemia)(Figure 1C). The frequency of the finding ranged from 13.6 percentin M0 tumors (minimally differentiated AML) to 87.5 percentin M5b specimens (acute monocytic leukemia). Most NPMc+ AMLtumors of the M5b and M6 subtypes (acute erythroid leukemia)and about 30 percent of NPMc+ tumors of the M1 (AML withoutmaturation), M2 (AML with maturation), and M4 (acute myelomonocyticleukemia) subtypes showed cytoplasmic NPM in erythroid precursors,particularly proerythroblasts (Figure 1D), and less frequentlyin megakaryocytes (data not shown).
This multilineage distribution of the NPMc+ pattern promptedan investigation of CD34 and CD133 antigens, which occur onhematopoietic stem cells. Twelve of 159 NPMc+ AML specimens(7.5 percent) contained at least 20 percent CD34-positive cells,as compared with 227 of 317 NPMc– AML specimens (71.6percent) (P<0.001) (Figure 2A through 2E). CD34-negativeNPMc+ AML specimens also did not contain CD133 (Figure 2F).
Figure 2. Association between Cytoplasmic Expression of Nucleophosmin (NPM) and CD34 Negativity.
Panel A shows CD34 expression according to French–American–British (FAB) subtype in specimens from patients with acute myelogenous leukemia (AML) with cytoplasmic expression of (NPMc+). Panel B shows CD34 expression according to FAB subtype in specimens from patients with AML without cytoplasmic expression of NPM (NPMc–). Panel C shows CD34 and subcellular NPM expression in 221 AML specimens with a normal karyotype. Panel D shows an NPMc+ AML specimen with a normal karyotype; there is no CD34 expression (alkaline phosphatase monoclonal anti–alkaline phosphatase [APAAP] technique). Panel E shows an NPMc– AML specimen with a normal karyotype; it is strongly positive for CD34 (APAAP technique). Panel F shows the results of fluorescence-activated cell-sorting analysis of NPMc+ AML specimens: the left-hand graph shows the control analysis; the middle graph, leukemic cells that lack CD34 and CD133; and the right-hand graph, leukemic cells that coexpress CD33 and CD13. IgG1 and IgG2 denote mouse immunoglobulin isotype controls; FITC denotes fluorescein isothiocyanate, and PE phycoerythrin.
Karyotypes
Cytogenetic data were available for 493 of the 591 patientswith AML (166 NPMc+ and 327 NPMc–). The karyotype wasnormal in 142 of the 166 patients with NPMc+ AML (85.5 percent),as compared with 88 of the 327 patients with NPMc– AML(26.9 percent) (P<0.001) (Figure 3A; details available from). Thus, 142 of the 230 AML specimens with a normal karyotype(61.7 percent) were NPMc+ (Figure 3B). Of the 24 specimens ofNPMc+ AML with an abnormal karyotype, 12 had cells in normaland abnormal metaphase (details available from ). No case ofAML associated with specific genetic abnormalities was NPMc+(Figure 3B, Figure 3C, and Figure 3D) (details available from).
Figure 3. Association between Acute Myelogenous Leukemia (AML) with Cytoplasmic Expression of Nucleophosmin (NPM) and a Normal Karyotype.
Panel A shows the results of analysis of 493 patients enrolled in the GIMEMA/EORTC trials. Cases of AML with cytoplasmic expression of NPM (NPMc+) mainly cluster with a normal karyotype. NPMc– denotes absence of cytoplasmic expression of NPM. Panel B shows the results of analysis of the 493 patients and 109 other patients not enrolled in the GIMEMA/EORTC trials — 70 with acute promyelocytic leukemia with a t(15;17) translocation and 39 with AML with major chromosomal rearrangements. NPMc+ AML accounts for about 60 percent of the cases of AML with a normal karyotype, and it never occurs with specific chromosomal abnormalities. In 24 cases there are other (minor) chromosomal abnormalities (details available from ). MLL denotes the mixed-lineage leukemia gene, DEK-CAN the DEK–nucleoporin 214 kD gene, and PML-RAR the promyelocytic leukemia–retinoic acid receptor gene. Panel C shows a specimen from a patient with acute promyelocytic leukemia (subtype M3) (left-hand image) with NPM expression restricted to the nucleus (right-hand image) (alkaline phosphatase monoclonal anti–alkaline phosphatase [APAAP] technique). Panel D shows a specimen from a patient with acute myelogenous leukemia (subtype M4eo) (left-hand image) with NPM expression restricted to the nucleus (right-hand image) (APAAP technique).
FLT3 Mutations
Internal tandem duplication of the FLT3 gene was detected in59 of 219 patients with AML who had a normal karyotype (26.9percent), and a mutation at aspartic acid residue 835 (D835)in FLT3 was detected in 13 of 202 such patients (6.4 percent).One patient carried both an internal tandem duplication andthe D835 mutation. Internal tandem duplication of this genewas twice as frequent in cases of NPMc+ disease as it was incases of NPMc– disease (P<0.003) (see Supplementary Appendix 1B).A multivariate logistic-regression model adjustedfor age and cytogenetic features established an independentassociation between cytoplasmic NPM (the dependent variable)and internal tandem duplication in FLT3. No statistical associationwas found between D835 mutations in FLT3 and the subcellularlocalization of NPM, possibly because of the small number ofcases involving a D835 mutation.
Response to Induction Therapy
Between 1999 and 2002, 539 patients with AML were enrolled inthe GIMEMA LAM99P trial. All the patients received the sameinduction therapy (see Supplementary Appendix 1A). The associationbetween the subcellular localization of NPM and the responseto induction therapy was evaluated in 126 patients with a normalkaryotype for whom NPM immunostaining and clinical informationwere available. There were 63 men and 63 women, the median ageat diagnosis was 49 years (range, 19 to 60), and the medianwhite-cell count at diagnosis was 28.4x103 per cubic millimeter(range, 0.6x103 to 400.0x103). The distribution of FAB subtypeswas as follows: M0 (5 patients), M1 (23), M2 (42), M4 (25),M5 (28), and M6 (3). An FLT3 mutation was present in 45 patients(36 percent), and cytoplasmic NPM was present in 79 (63 percent).
The median ages of patients with NPMc+ and NPMc– tumorswere 51.8 and 41.9 years, respectively (P<0.001). There wereno significant differences between the two groups at presentationin terms of sex, white-cell count, FAB subtypes, FLT3 status,and clinical features.
Of the 126 patients, 90 (71 percent) had complete remissionafter induction therapy. In a univariate analysis, a lower white-cellcount at presentation was associated with a higher rate of completeresponse (78 percent among patients with a white-cell countof 80x103 per cubic millimeter or below vs. 50 percent amongthose with a white-cell count above 80x103 per cubic millimeter)(P<0.003). There was no statistically significant differencein the rates of complete response between patients with NPMc+tumors (77 percent) and those with NPMc– tumors (62 percent)(P=0.070). There was resistance to treatment in 9 percent ofpatients with NPMc+ tumors and in 23 percent of those with NPMc–tumors. Sex, age, FAB subtype, and FLT3 status were not associatedwith the rate of complete response.
A multivariate logistic-regression model that included the white-cellcount, age, NPM localization (nuclear or cytoplasmic), and thepresence or absence of an FLT3 mutation showed that a lowerwhite-cell count and cytoplasmic expression of NPM are independentprognostic factors for a complete remission. A white-cell countabove 80x103 per cubic millimeter was found to have a negativeeffect (P=0.006; odds ratio, 0.27 [95 percent confidence interval,0.11 to 0.68]) and the NPMc+ pattern to have a positive effect(P=0.019; odds ratio, 2.98 [95 percent confidence interval,1.2 to 7.43]) (Table 2).
Table 2. Logistic-Regression Analysis of the Effect of Prognostic Factors for a Response to Induction Therapy in 126 Patients with Acute Myelogenous Leukemia.
Mutations in NPM Exon 12 in NPMc+ AML
In none of the NPMc+ AML specimens was NPM-ALK,13 NPM-RAR,14NPM-MLF1,15 or any other NPM-containing fusion protein found.Transcripts of the corresponding fusion genes were not foundby FISH or RT-PCR, and FISH did not detect other NPM translocations.Western blotting showed only the expected 38-kD NPM polypeptide.The finding of cytoplasmic positivity with a monoclonal antibodydirected against the NPM C-terminal (which is not retained inNPM fusion proteins)5 further supported the presence of full-lengthNPM in the cytoplasm of leukemic cells.
RT-PCR and direct sequencing of the NPM coding region revealedmutations affecting exon 12 in all but one case of NPMc+ disease(Table 1 and Supplementary Appendix 1C). Figure 4 shows a schematicdiagram of the NPM gene and summarizes the mutations. Six sequencevariants were observed, all leading to a frame shift in theregion encoding the C-terminal of the NPM protein. The mostfrequent mutation (which we have called mutation A) was a duplicationof a TCTG tetranucleotide at positions 956 through 959 of thereference sequence (GenBank accession number NM_002520
[GenBank]
) (Figure 4Band Figure 4C); the resulting shift in the reading frameis predicted to alter the C-terminal portion of the NPM proteinby replacing the last seven amino acids (WQWRKSL, where theamino acids are designated by their single-letter codes) with11 different residues (CLAVEEVSLRK). Three additional mutations(called B, C, and D) included distinct 4-bp insertions at position960, resulting in the same frame shift as mutation A. In thelast two mutations (called E and F), nucleotides 965 through969 (GGAGG) were deleted and two different 9-bp sequences wereinserted, leading to the same frame shift and to a distinctC-terminal consisting of nine amino acids. All six NPM mutantproteins showed mutations in at least one of the tryptophanresidues at positions 288 and 290 and shared the same last fiveamino acid residues (VSLRK) (Figure 4B). Thus, despite geneticheterogeneity, all NPM gene mutations result in a distinct sequencein the NPM protein C-terminal. The sequences of the six mutatedNPM alleles have been deposited in the National Center for BiotechnologyInformation database (GenBank accession numbers AY740634
[GenBank]
throughAY740639
[GenBank]
).
Figure 4. Mutations in Exon 12 of the Nucleophosmin (NPM) Gene and in the Encoded Protein.
Panel A shows a schematic representation of the NPM gene as deduced from GenBank sequences NM_002520
[GenBank]
, NM_199185
[GenBank]
, and AB042278
[GenBank]
. Green indicates coding sequences, and yellow 3' and 5' untranslated regions. MB denotes metal-binding domain, Ac acidic domain, NLS nuclear localization signal, and NAB nucleic acid–binding domain. Primers for amplification of genomic DNA (NPM1-F and NPM1-R [blue arrowheads]) and complementary DNA (NPM1_25F and NPM1_1112R [red arrowheads]) are shown in their approximate positions above the map. In Panel B, the wild-type NPM sequence (nucleotides 952 through 989) is aligned with six mutant variants, called A to F. Red type indicates nucleotide insertions. The predicted protein is also shown, with boxed areas indicating the positions of the two C-terminal tryptophan (W) residues; the wild-type tryptophan residue, is shown in yellow, and the mutated residues are shown in gray. The new amino-acid sequence common to all the mutated proteins is shown in green. For each variant, the number and percentage of affected cases, of the 52 total NPMc+ cases, are given. Panel C shows sequencing results from one patient bearing mutation A, as obtained by direct sequencing (top diagram) and after cloning and sequencing of the two individual alleles (middle [wild-type] and bottom [mutated allele] diagrams). The arrow and the dashed line indicate the position where the two alleles diverge, and the box indicates the most frequently mutated nucleotides. As shown in the images in Panel D, the mutated NPM protein is dislocated in the cytoplasm. The images are tridimensional reconstructions of confocal micrographs of NIH-3T3 cells transfected with plasmids encoding wild-type and mutant NPM alleles tagged with enhanced green fluorescent protein; the nuclei were counterstained with propidium iodide (which appears as red). The wild-type protein is located in the nucleoli and nuclear membrane, whereas the mutated NPM shows aberrant cytoplasmic localization.
Mutations in exon 12 of NPM and their specific association withcases of NPMc+ AML were confirmed by sequence analysis of genomicDNA in 11 available specimens. The mutations were heterozygousand were related only to the malignant clone, since they werenot present in bone marrow specimens from the five patientsin complete remission. Mutations were observed in a wide varietyof FAB categories of NPMc+ AML and even in cases with abnormalkaryotypes or CD34 expression (Table 1 and Supplementary Appendix 1C).All NPMc– AML tumors and neoplasms other than AMLhad wild-type NPM sequences.
Transfection of Mutated NPM
To test whether mutations in NPM exon 12 caused cytoplasmicdislocation of NPM, NIH-3T3 cells were transiently transfectedwith expression vectors encoding wild-type and mutant allelesfused with EGFP. Confocal microscopy showed nucleolar localizationof the EGFP–NPM wild-type protein. The mutant form ofNPM was dislocated into the cytoplasm (Figure 4D and Supplementary Appendix 1D)— a finding that suggested that the geneticevent correlated with the subcellular localization of NPM.
Discussion
We found that cytoplasmic NPM is the hallmark of a distincttype of AML that constitutes about one third of the cases ofprimary AML in adults (excluding FAB subtype M3). Patients withthis type of AML have a normal karyotype, a mutant NPM gene,and a relatively good response to induction chemotherapy. Moreover,of the patients with AML who had a normal karyotype, cytoplasmicNPM was found in about 60 percent. Our findings are importantbecause no chromosomal rearrangement is visible by standardkaryotyping in 40 to 50 percent of cases of AML,1 and uncertaintyclouds some of the biologic and clinical features in these patients.
Mutations in NPM exon 12 and the resulting shift of NPM intothe cytoplasm are the most specific and frequent events we havefound in AML with a normal karyotype. Mutations of the FLT325,26and CEBPA27 genes or MLL self-fusion28 also occurs in primaryAML with a normal karyotype or recurrent genetic abnormalities23,29and in secondary AML.30 The chromosomal abnormalities we foundin about 14 percent of cases of NPMc+ AML are probably secondary,as indicated by the frequent occurrence of cells with an abnormalkaryotype as subclones within the population with a normal karyotypeand similarity with the type and incidence of secondary chromosomalchanges in AML with recurrent genetic abnormalities.31
Internal tandem duplication of FLT3 was seen twice as oftenin cases of NPMc+ AML as it was in cases of NPMc– AML,suggesting that the FLT3 and NPM mutations are mechanisticallylinked. NPMc+ AML is CD34-negative, has a wide morphologic spectrum,and demonstrates multilineage involvement. These features mightreflect derivation of this type of AML from the few lineage-marker–negative,CD34-negative, CD38-negative hematopoietic stem cells in bonemarrow.32 Alternatively, CD34 might be down-regulated as resultof the leukemic transformation.
Our transfection experiments established a causal relationshipbetween NPM mutations and NPM cytoplasmic dislocation, in keepingwith data from mutant rat NPM showing that the C-terminal region(in particular, the tryptophan residues at positions 286 and288) is necessary for nucleolar localization of NPM.33 All predictedproteins encoded by the six variant mutations in our patientswere altered in at least one of the critical tryptophan residuesat positions 288 and 290.
NPMc+ AML might originate from a small, undetectable subsetof pluripotent hematopoietic stem cells that normally harbora mutated form of NPM. It is more likely, however, that mutationof NPM and cytoplasmic dislocation of NPM are primary leukemogenicevents. The mutation might interfere with normal NPM functions— including stabilization of p53 in the nucleus when DNAis damaged9,10 and direct interaction with the tumor-suppressorgene ARF to regulate the cell cycle34 — by sequesteringthe protein in the cytoplasm. The mutation might also perturbother NPM functions that have been mapped within its C-terminalregion, such as nucleic acid binding,35 ATP binding,36 and stimulationof DNA polymerase activity.37
Our findings have several diagnostic and prognostic implications.Detection of cytoplasmic NPM by a sensitive, specific, simple,inexpensive, and rapid assay done on paraffin sections frombone marrow trephine specimens or marrow clots could be usedto rule out recurrent chromosomal abnormalities. CytoplasmicNPM also appears to be a reliable predictor of mutations inNPM exon 12 in AML with a normal karyotype.
The identification of the NPMc+ AML genetic subtype within theheterogeneous World Health Organization category of primaryAML "not otherwise characterized"38 may have repercussions forAML classification. Cases of AML are currently assigned to prognosticgroups according to cytogenetic and molecular findings.1,25,39AML with a normal karyotype that cannot be classified by cytogeneticmeans (as in about 20 percent of the cases in this study) becauseof the lack of a specimen, deterioration of the specimen, orabsence of mitoses could be assigned to the intermediate-riskcategory by detection of cytoplasmic NPM. Moreover, the associationof cytoplasmic NPM with primary AML has prognostic significance,since secondary AMLs usually carry a poor prognosis.
Finally, cytoplasmic NPM is associated with responsiveness toinduction therapy, although its role (alone or in combinationwith FLT3) in predicting the outcome of AML with a normal karyotypeafter remission remains to be defined. Immunohistochemistryplus mutational analysis of NPM may assist in the monitoringof minimal residual disease in a setting (normal karyotype andCD34 negativity) in which no molecular or immunophenotypic markersare available. Understanding the mechanisms leading to leukemogenesisin NPMc+ AML may lead to more specific antileukemia therapies.40
Supported by the Associazione Italiana per la Ricerca sul Cancro,the Associazione Italiana contro le Leucemie, and the MinisteroIstruzione Università e Ricerca and by a Livia Benedettigrant (to Dr. Tiacci). Dr. Pasqualucci is a Special Fellow ofthe Leukemia and Lymphoma Society. Drs. Falini and Mecucci haveapplied for an Italian patent regarding clinical applicationsof nucleophosmin mutations.
We are indebted to Marco Mancini, Antonio Cuneo, Nicoletta Testoni,and Giovanna Rege-Cambrin for conventional cytogenetic analyses;to Fabrizio Pane for molecular studies on recurrent translocationsand FLT3 mutational status; to Paolo Gorello for help with theanalysis of NPM mutations; to Vladan Miljkovic for assistancewith DNA sequencing; to Alessia Tabarrini and Federica Frenguellifor histologic and immunohistological studies; to FrancescaPaoloni, Simona Iacobelli, and Stefano Ricci for statisticalcontributions; to Marco Fizzotti, Pier-Luigi Orvietani, andBarbara Verducci for Western blotting studies; to Ildo Nicolettifor the confocal microscopical analysis; and to Claudia Tibidòfor assistance in the preparation of the manuscript. This articleis dedicated to the memory of Carlo Falini.
* The centers and investigators participating in the GIMEMA Studyare listed in the Appendix.
See NAPS document no. PC0002 for 17 pages of supplementary material.To order, contact NAPS, c/o Burrows Systems, P.O. Box 3976,New Hyde Park, NY 11040.
Source Information
From the Institute of Hematology (B.F., C.M., E.T., R.R., L.P., R.L.S., A.S., B.B., R.P., A.P., M.F.M.) and the Department of Biochemistry and Molecular Biotechnology (V.P.), University of Perugia, Perugia, Italy; the European Institute of Oncology, Milan, Italy (M.A., E.C., N.M., P.-G.P.); the Institute for Cancer Genetics, Columbia University, New York (L.P.); the Institute of Hematology, University La Sapienza, Rome (D.D., F.M.); the Institute of Hematology, University of Foggia, Foggia, Italy (A.L.); the Gruppo Italiano Malattie Ematologiche dell'Adulto (GIMEMA) Data Center, Rome (M.V., P.F.); the Division of Internal Medicine and Hematology, Ospedale S. Luigi, Orbassano-Turin, Italy (G.S.); and the Department of Biopathology, University of Tor Vergata, Rome (F.L.-C.). Drs. Tiacci, Alcalay, and Rosati contributed equally to this article.
Address reprint requests to Dr. Falini at the Institute of Hematology, Policlinico Monteluce, 06122 Perugia, Italy, or at faliniem{at}unipg.it.
References
Grimwade D, Walker H, Oliver F, et al. The importance of diagnostic cytogenetics on outcome in AML: analysis of 1,612 patients entered into the MRC AML 10 trial. Blood 1998;92:2322-2333. [Free Full Text]
Bullinger L, Döhner K, Bair E, et al. Use of gene-expression profiling to identify prognostic subclasses in adult acute myeloid leukemia. N Engl J Med 2004;350:1605-1616. [Free Full Text]
Valk PJ, Verhaak RG, Beijen MA, et al. Prognostically useful gene-expression profiles in acute myeloid leukemia. N Engl J Med 2004;350:1617-1628. [Free Full Text]
Borer RA, Lehner CF, Eppenberger HM, Nigg EA. Major nucleolar proteins shuttle between nucleus and cytoplasm. Cell 1989;56:379-390. [CrossRef][ISI][Medline]
Cordell JL, Pulford KA, Bigerna B, et al. Detection of normal and chimeric nucleophosmin in human cells. Blood 1999;93:632-642. [Free Full Text]
Dumbar TS, Gentry GA, Olson MO. Interaction of nucleolar phosphoprotein B23 with nucleic acids. Biochemistry 1989;28:9495-9501. [CrossRef][Medline]
Okuda M, Horn HF, Tarapore P, et al. Nucleophosmin/B23 is a target of CDK2/cyclin E in centrosome duplication. Cell 2000;103:127-140. [CrossRef][ISI][Medline]
Bertwistle D, Sugimoto M, Sherr CJ. Physical and functional interactions of the Arf tumor suppressor protein with nucleophosmin/B23. Mol Cell Biol 2004;24:985-996. [Free Full Text]
Colombo E, Marine JC, Danovi D, Falini B, Pelicci PG. Nucleophosmin regulates the stability and transcriptional activity of p53. Nat Cell Biol 2002;4:529-533. [CrossRef][ISI][Medline]
Kurki S, Peltonen K, Latonen L, et al. Nucleolar protein NPM interacts with HDM2 and protects tumor suppressor protein p53 from HDM2-mediated degradation. Cancer Cell 2004;5:465-475. [CrossRef][ISI][Medline]
Falini B, Pileri S, Zinzani PL, et al. ALK+ lymphoma: clinico-pathological findings and outcome. Blood 1999;93:2697-2706. [Free Full Text]
Falini B, Mason DY. Proteins encoded by genes involved in chromosomal alterations in lymphoma and leukemia: clinical value of their detection by immunocytochemistry. Blood 2002;99:409-426. [Free Full Text]
Morris SW, Kirstein MN, Valentine MB, et al. Fusion of a kinase gene, ALK, to a nucleolar protein gene, NPM, in non-Hodgkin's lymphoma. Science 1994;263:1281-1284. [Erratum, Science 1995;267:316-7.] [Free Full Text]
Redner RL, Rush EA, Faas S, Rudert WA, Corey SJ. The t(5;17) variant of acute promyelocytic leukemia expresses a nucleophosmin-retinoic acid receptor fusion. Blood 1996;87:882-886. [Free Full Text]
Yoneda-Kato N, Look AT, Kirstein MN, et al. The t(3;5)(q25.1;q34) of myelodysplastic syndrome and acute myeloid leukemia produces a novel fusion gene, NPM-MLF1. Oncogene 1996;12:265-275. [ISI][Medline]
Bischof D, Pulford K, Mason DY, Morris SW. Role of the nucleophosmin (NPM) portion of the non-Hodgkin's lymphoma-associated NPM-anaplastic lymphoma kinase fusion protein in oncogenesis. Mol Cell Biol 1997;17:2312-2325. [Abstract]
Falini B, Pulford K, Pucciarini A, et al. Lymphomas expressing ALK fusion protein(s) other than NPM-ALK. Blood 1999;94:3509-3515. [Free Full Text]
Cordell JL, Falini B, Erber WN, et al. Immunoenzymatic labeling of monoclonal antibodies using immune complexes of alkaline phosphatase and monoclonal anti-alkaline phosphatase (APAAP complexes). J Histochem Cytochem 1984;32:219-229. [Abstract]
Mitelman F. ISCN 1995: an international system for human cytogenetic nomenclature. Basel, Switzerland: Karger, 1995.
Crescenzi B, Fizzotti M, Piattoni S, et al. Interphase FISH for Y chromosome, VNTR polymorphisms, and RT-PCR for BCR-ABL in the monitoring of HLA-matched and mismatched transplants. Cancer Genet Cytogenet 2000;120:25-29. [CrossRef][ISI][Medline]
van Dongen JJ, Macintyre EA, Gabert JA, et al. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease: report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia 1999;13:1901-1928. [CrossRef][ISI][Medline]
Soekarman D, von Lindern M, Daenen S, et al. The translocation (6;9)(p23;q34) shows consistent rearrangement of two genes and defines a myeloproliferative disorder with specific clinical features. Blood 1992;79:2990-2997. [Free Full Text]
Noguera NI, Breccia M, Divona M, et al. Alterations of the FLT3 gene in acute promyelocytic leukemia: association with diagnostic characteristics and analysis of clinical outcome in patients treated with the Italian AIDA protocol. Leukemia 2002;16:2185-2189. [CrossRef][ISI][Medline]
Cimino G, Rapanotti MC, Elia L, et al. ALL-1 gene rearrangements in acute myeloid leukemia: association with M4-M5 French-American-British classification subtypes and young age. Cancer Res 1995;55:1625-1628. [Free Full Text]
Schnittger S, Schoch C, Dugas M, et al. Analysis of FLT3 length mutations in 1003 patients with acute myeloid leukemia: correlation to cytogenetics, FAB subtype, and prognosis in the AMLCG study and usefulness as a marker for the detection of minimal residual disease. Blood 2002;100:59-66. [Free Full Text]
Frohling S, Schlenk RF, Breitruck J, et al. Prognostic significance of activating FLT3 mutations in younger adults (16 to 60 years) with acute myeloid leukemia and normal cytogenetics: a study of the AML Study Group Ulm. Blood 2002;100:4372-4380. [Free Full Text]
Pabst T, Mueller BU, Zhang P, et al. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat Genet 2001;27:263-270. [CrossRef][ISI][Medline]
Steudel C, Wermke M, Schaich M, et al. Comparative analysis of MLL partial tandem duplication and FLT3 internal tandem duplication mutations in 956 adult patients with acute myeloid leukemia. Genes Chromosomes Cancer 2003;37:237-251. [CrossRef][ISI][Medline]
Carnicer MJ, Nomdedeu JF, Lasa A, et al. FLT3 mutations are associated with other molecular lesions in AML. Leuk Res 2004;28:19-23. [CrossRef][ISI][Medline]
Christiansen DH, Pedersen-Bjergaard J. Internal tandem duplications of the FLT3 and MLL genes are mainly observed in atypical cases of therapy-related acute myeloid leukemia with a normal karyotype and are unrelated to type of previous therapy. Leukemia 2001;15:1848-1851. [ISI][Medline]
Slovak ML, Kopecky KJ, Cassileth PA, et al. Karyotypic analysis predicts outcome of preremission and postremission therapy in adult acute myeloid leukemia: a Southwest Oncology Group/Eastern Cooperative Oncology Group Study. Blood 2000;96:4075-4083. [Free Full Text]
Goodell MA, Rosenzweig M, Kim H, et al. Dye efflux studies suggest that hematopoietic stem cells expressing low or undetectable levels of CD34 antigen exist in multiple species. Nat Med 1997;3:1337-1345. [CrossRef][ISI][Medline]
Nishimura Y, Ohkubo T, Furuichi Y, Umekawa H. Tryptophans 286 and 288 in the C-terminal region of protein B23.1 are important for its nucleolar localization. Biosci Biotechnol Biochem 2002;66:2239-2242. [CrossRef][Medline]
Brady SN, Yu Y, Maggi LB Jr, Weber JD. ARF impedes NPM/B23 shuttling in an Mdm2-sensitive tumor suppressor pathway. Mol Cell Biol 2004;24:9327-9338. [Free Full Text]
Hingorani K, Szebeni A, Olson MO. Mapping the functional domains of nucleolar protein B23. J Biol Chem 2000;275:24451-24457. [Free Full Text]
Chang JH, Lin JY, Wu MH, Yung BY. Evidence for the ability of nucleophosmin/B23 to bind ATP. Biochem J 1998;329:539-544.
Umekawa H, Sato K, Takemura M, et al. The carboxyl terminal sequence of nucleolar protein B23.1 is important in its DNA polymerase alpha-stimulatory activity. J Biochem (Tokyo) 2001;130:199-205. [Free Full Text]
Jaffe ES, Harris NL, Stein H, Vardiman JW, eds. Pathology and genetics of tumours of haematopoietic and lymphoid tissues. Lyon, France: IARC Press, 2001.
Byrd JC, Mrozek K, Dodge RK, et al. Pretreatment cytogenetic abnormalities are predictive of induction success, cumulative incidence of relapse, and overall survival in adult patients with de novo acute myeloid leukemia: results from Cancer and Leukemia Group B (CALGB 8461). Blood 2002;100:4325-4336. [Free Full Text]
Kau TR, Way JC, Silver PA. Nuclear transport and cancer: from mechanism to intervention. Nat Rev Cancer 2004;4:106-117. [ISI][Medline]
Appendix
The centers and investigators contributing to the GIMEMA Studywere as follows (listed in order of the number of cases provided):Istituto di Ematologia, Università La Sapienza, Rome(G. Meloni); Divisione di Ematologia, Ospedale V. Cervello,Palermo (F. Fabbiano); Cattedra di Ematologia, Bari (V. Liso);Divisione di Ematologia, Azienda USL di Pescara, Pescara (M.Sborgia); Ospedale Ferrarotto S. Bambino, Catania (F. Di Raimondo);Divisione di Ematologia, Ospedale S. Eugenio, Rome (A. Venditti);Divisione di Ematologia e Oncologia Clinica, Catanzaro (D. Magro);Dipartimento di Emato-Oncologia, Azienda Ospedaliera Bianchi-Melacrino-Morelli,Reggio Calabria (F. Nobile); Istituto di Ematologia, UniversitàFederico II, Naples (B. Rotoli); Azienda Ospedaliera S.G. Moscati,Avellino (N. Cantore); Divisione di Ematologia, Ospedale CasaSollievo della Sofferenza, S. Giovanni Rotondo (L. Melillo);Istituto di Ematologia, Ospedale A. Businco, Cagliari (E. Angelucci);Istituto di Ematologia, Policlinico Monteluce, Perugia (A. Tabilio);Cattedra di Ematologia, Ospedale S. Chiara, Pisa (M. Petrini);Policlinico Gemelli, Rome (S. Sica); Università di Ancona,Ancona (P. Leoni); Sezione di Medicina Interna, Oncologia edEmatologia, Dipartimento Scienze Mediche, Oncologiche e Radiologiche,Modena (G. Torelli); Divisione di Ematologia, Ospedale SS. Antonioe Biagio, Alessandria (A. Levis); Divisione di Ematologia, FondazioneCentro S. Raffaele del Monte Tabor, Milan (L. Camba); Divisionedi Ematologia, Ospedale S. Carlo, Potenza (F. Ricciuti); Divisionedi Ematologia, Ospedale S. Giovanni Bosco, Naples (E. Miraglia);Azienda Ospedaliera A. Di Summa, Brindisi (G. Quarta); Divisionedi Ematologia, Ospedale S. Francesco, Nuoro (A. Gabbas); Divisionedi Ematologia con Trapianto Midollo Osseo, Universitàdi Palermo, Palermo (M.E. Mitra); Cattedra di Ematologia–CentroTrapianto Midollo Osseo, Università di Parma, Parma (V.Rizzoli); Divisione Ematologica di Muraglia, Ospedale S. Salvatore,Pesaro (G. Sparaventi); Divisione di Ematologia, Azienda OspedalieraCremona, Cremona (S. Moranti); Divisione di Ematologia, OspedaleS. Croce, Cuneo (A. Gallamini); Divisione di Medicina Interna,Ospedale S. Luigi, Orbassano (A. Serra); Sezione Ematologia,Dipartimento Scienze Biomediche, Arcispedale S. Anna, Ferrara(P.-L. Castaldi); Divisione di Ematologia, Universitàdi Sassari, Sassari (F. Dore); Divisione di Medicina, AziendaOspedaliera E. Morelli, Sondalo (E. Epis); Divisione Medicina1, Ospedale S. Antonio Abate, Gallarate (R. Mozzana); DivisioneMedica, Ospedale Maggiore, Lodi (G. Nalli); Azienda SanitariaLocale Salerno 1, Medicina Interna, Ematologia–Oncologia,Nocera Inferiore (A.M. D'Arco); Divisione di Ematologia, PoliclinicoCareggi, Florence (P.-L. Rossi Ferrini); Unità OperativaEmatologia, Ospedale di Foggia, Foggia (M. Monaco); Divisionedi Ematologia, Ospedale di Messina, Messina (M. Brugiatelli);and S. Vincenzo, Ospedale di Taormina, Divisione di Ematologia,Taormina (M. Russo) — all in Italy.
Di Fiore, P. P.
(2008). Playing both sides: nucleophosmin between tumor suppression and oncogenesis. J. Cell Biol.
182: 7-9
[Abstract][Full Text]
Bonetti, P., Davoli, T., Sironi, C., Amati, B., Pelicci, P. G., Colombo, E.
(2008). Nucleophosmin and its AML-associated mutant regulate c-Myc turnover through Fbw7{gamma}. J. Cell Biol.
182: 19-26
[Abstract][Full Text]
Dohner, K., Dohner, H.
(2008). Molecular characterization of acute myeloid leukemia. haematol
93: 976-982
[Full Text]
Laughlin, T. S., Becker, M. W., Liesveld, J. L., Mulford, D. A., Abboud, C. N., Brown, P., Rothberg, P. G.
(2008). Rapid Method for Detection of Mutations in the Nucleophosmin Gene in Acute Myeloid Leukemia. J. Mol. Diagn.
10: 338-345
[Abstract][Full Text]
Pulsoni, A., Iacobelli, S., Bernardi, M., Borgia, M., Camera, A., Cantore, N., Di Raimondo, F., Fazi, P., Ferrara, F., Leoni, F., Liso, V., Mancini, M., Marmont, F., Matturro, A., Maurillo, L., Melillo, L., Meloni, G., Mirto, S., Specchia, G., Valentini, C. G., Venditti, A., Leone, G., Foa, R., Mandelli, F., Pagano, L.
(2008). M4 acute myeloid leukemia: the role of eosinophilia and cytogenetics in treatment response and survival. The GIMEMA experience. haematol
93: 1025-1032
[Abstract][Full Text]
Lo-Coco, F., Cuneo, A., Pane, F., Cilloni, D., Diverio, D., Mancini, M., Testoni, N., Bardi, A., Izzo, B., Bolli, N., La Starza, R., Fazi, P., Iacobelli, S., Piciocchi, A., Vignetti, M., Amadori, S., Mandelli, F., Pelicci, P. G., Mecucci, C., Falini, B., Saglio, G., for the Acute Leukemia Working Party of the GIMEMA,
(2008). Prognostic impact of genetic characterization in the GIMEMA LAM99P multicenter study for newly diagnosed acute myeloid leukemia. haematol
93: 1017-1024
[Abstract][Full Text]
Lindstrom, M. S., Zhang, Y.
(2008). Ribosomal Protein S9 Is a Novel B23/NPM-binding Protein Required for Normal Cell Proliferation. J. Biol. Chem.
283: 15568-15576
[Abstract][Full Text]
Langer, C., Radmacher, M. D., Ruppert, A. S., Whitman, S. P., Paschka, P., Mrozek, K., Baldus, C. D., Vukosavljevic, T., Liu, C.-G., Ross, M. E., Powell, B. L., de la Chapelle, A., Kolitz, J. E., Larson, R. A., Marcucci, G., Bloomfield, C. D.
(2008). High BAALC expression associates with other molecular prognostic markers, poor outcome, and a distinct gene-expression signature in cytogenetically normal patients younger than 60 years with acute myeloid leukemia: a Cancer and Leukemia Group B (CALGB) study. Blood
111: 5371-5379
[Abstract][Full Text]
Schlenk, R. F., Dohner, K., Krauter, J., Frohling, S., Corbacioglu, A., Bullinger, L., Habdank, M., Spath, D., Morgan, M., Benner, A., Schlegelberger, B., Heil, G., Ganser, A., Dohner, H., the German-Austrian Acute Myeloid Leukemia Study,
(2008). Mutations and Treatment Outcome in Cytogenetically Normal Acute Myeloid Leukemia. NEJM
358: 1909-1918
[Abstract][Full Text]
Ottone, T., Ammatuna, E., Lavorgna, S., Noguera, N. I., Buccisano, F., Venditti, A., Gianni, L., Postorino, M., Federici, G., Amadori, S., Lo-Coco, F.
(2008). An Allele-Specific RT-PCR Assay to Detect Type A Mutation of the Nucleophosmin-1 Gene in Acute Myeloid Leukemia. J. Mol. Diagn.
10: 212-216
[Abstract][Full Text]
Wertheim, G., Bagg, A.
(2008). Nucleophosmin (NPM1) Mutations in Acute Myeloid Leukemia: An Ongoing (Cytoplasmic) Tale of Dueling Mutations and Duality of Molecular Genetic Testing Methodologies. J. Mol. Diagn.
10: 198-202
[Abstract][Full Text]
Szankasi, P., Jama, M., Bahler, D. W.
(2008). A New DNA-Based Test for Detection of Nucleophosmin Exon 12 Mutations by Capillary Electrophoresis. J. Mol. Diagn.
10: 236-241
[Abstract][Full Text]
Falini, B., Martelli, M. P., Mecucci, C., Liso, A., Bolli, N., Bigerna, B., Pucciarini, A., Pileri, S., Meloni, G., Martelli, M. F., Haferlach, T., Schnittger, S.
(2008). Cytoplasmic mutated nucleophosmin is stable in primary leukemic cells and in a xenotransplant model of NPMc+ acute myeloid leukemia in SCID mice. haematol
93: 775-779
[Abstract][Full Text]
Sportoletti, P., Grisendi, S., Majid, S. M., Cheng, K., Clohessy, J. G., Viale, A., Teruya-Feldstein, J., Pandolfi, P. P.
(2008). Npm1 is a haploinsufficient suppressor of myeloid and lymphoid malignancies in the mouse. Blood
111: 3859-3862
[Abstract][Full Text]
Garzon, R., Garofalo, M., Martelli, M. P., Briesewitz, R., Wang, L., Fernandez-Cymering, C., Volinia, S., Liu, C.-G., Schnittger, S., Haferlach, T., Liso, A., Diverio, D., Mancini, M., Meloni, G., Foa, R., Martelli, M. F., Mecucci, C., Croce, C. M., Falini, B.
(2008). Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc. Natl. Acad. Sci. USA
105: 3945-3950
[Abstract][Full Text]
Falini, B., Mecucci, C., Saglio, G., Coco, F. L., Diverio, D., Brown, P., Pane, F., Mancini, M., Martelli, M. P., Pileri, S., Haferlach, T., Haferlach, C., Schnittger, S.
(2008). NPM1 mutations and cytoplasmic nucleophosmin are mutually exclusive of recurrent genetic abnormalities: a comparative analysis of 2562 patients with acute myeloid leukemia. haematol
93: 439-442
[Abstract][Full Text]
Bacher, U., Haferlach, C., Kern, W., Haferlach, T., Schnittger, S.
(2008). Prognostic relevance of FLT3-TKD mutations in AML: the combination matters--an analysis of 3082 patients. Blood
111: 2527-2537
[Abstract][Full Text]
Wandt, H., Schakel, U., Kroschinsky, F., Prange-Krex, G., Mohr, B., Thiede, C., Pascheberg, U., Soucek, S., Schaich, M., Ehninger, G.
(2008). MLD according to the WHO classification in AML has no correlation with age and no independent prognostic relevance as analyzed in 1766 patients. Blood
111: 1855-1861
[Abstract][Full Text]
Yoneda-Kato, N., Kato, J.-y.
(2008). Shuttling Imbalance of MLF1 Results in p53 Instability and Increases Susceptibility to Oncogenic Transformation. Mol. Cell. Biol.
28: 422-434
[Abstract][Full Text]
Stone, R. M.
(2008). Genetically Defined Prognostic Factors and Novel Therapeutics for AML. Am Soc Clin Oncol Ed Book
2008: 280-284
[Abstract][Full Text]
Kaspers, G. J.L., Zwaan, C. M.
(2007). Pediatric acute myeloid leukemia: towards high-quality cure of all patients. haematol
92: 1519-1532
[Abstract][Full Text]
Galietta, A., Gunby, R. H., Redaelli, S., Stano, P., Carniti, C., Bachi, A., Tucker, P. W., Tartari, C. J., Huang, C.-J., Colombo, E., Pulford, K., Puttini, M., Piazza, R. G., Ruchatz, H., Villa, A., Donella-Deana, A., Marin, O., Perrotti, D., Gambacorti-Passerini, C.
(2007). NPM/ALK binds and phosphorylates the RNA/DNA-binding protein PSF in anaplastic large-cell lymphoma. Blood
110: 2600-2609
[Abstract][Full Text]
Palmisano, M., Grafone, T., Ottaviani, E., Testoni, N., Baccarani, M., Martinelli, G.
(2007). NPM1 mutations are more stable than FLT3 mutations during the course of disease in patients with acute myeloid leukemia. haematol
92: 1268-1269
[Abstract][Full Text]
Ganapathi, K. A., Austin, K. M., Lee, C.-S., Dias, A., Malsch, M. M., Reed, R., Shimamura, A.
(2007). The human Shwachman-Diamond syndrome protein, SBDS, associates with ribosomal RNA. Blood
110: 1458-1465
[Abstract][Full Text]
Link, D. C., Kunter, G., Kasai, Y., Zhao, Y., Miner, T., McLellan, M. D., Ries, R. E., Kapur, D., Nagarajan, R., Dale, D. C., Bolyard, A. A., Boxer, L. A., Welte, K., Zeidler, C., Donadieu, J., Bellanne-Chantelot, C., Vardiman, J. W., Caligiuri, M. A., Bloomfield, C. D., DiPersio, J. F., Tomasson, M. H., Graubert, T. A., Westervelt, P., Watson, M., Shannon, W., Baty, J., Mardis, E. R., Wilson, R. K., Ley, T. J.
(2007). Distinct patterns of mutations occurring in de novo AML versus AML arising in the setting of severe congenital neutropenia. Blood
110: 1648-1655
[Abstract][Full Text]
Brown, P., McIntyre, E., Rau, R., Meshinchi, S., Lacayo, N., Dahl, G., Alonzo, T. A., Chang, M., Arceci, R. J., Small, D.
(2007). The incidence and clinical significance of nucleophosmin mutations in childhood AML. Blood
110: 979-985
[Abstract][Full Text]
Bolli, N., Nicoletti, I., De Marco, M. F., Bigerna, B., Pucciarini, A., Mannucci, R., Martelli, M. P., Liso, A., Mecucci, C., Fabbiano, F., Martelli, M. F., Henderson, B. R., Falini, B.
(2007). Born to Be Exported: COOH-Terminal Nuclear Export Signals of Different Strength Ensure Cytoplasmic Accumulation of Nucleophosmin Leukemic Mutants. Cancer Res.
67: 6230-6237
[Abstract][Full Text]
Liu, X., Liu, Z., Jang, S.-W., Ma, Z., Shinmura, K., Kang, S., Dong, S., Chen, J., Fukasawa, K., Ye, K.
(2007). Sumoylation of nucleophosmin/B23 regulates its subcellular localization, mediating cell proliferation and survival. Proc. Natl. Acad. Sci. USA
104: 9679-9684
[Abstract][Full Text]
Volpe, G., Cignetti, A., Panuzzo, C., Kuka, M., Vitaggio, K., Brancaccio, M., Perrone, G., Rinaldi, M., Prato, G., Fava, M., Geuna, M., Pautasso, M., Casnici, C., Signori, E., Tonon, G., Tarone, G., Marelli, O., Fazio, V. M., Saglio, G.
(2007). Alternative BCR/ABL Splice Variants in Philadelphia Chromosome-Positive Leukemias Result in Novel Tumor-Specific Fusion Proteins that May Represent Potential Targets for Immunotherapy Approaches. Cancer Res.
67: 5300-5307
[Abstract][Full Text]
Steensma, D. P.
(2007). The spectrum of molecular aberrations in myelodysplastic syndromes: in the shadow of acute myeloid leukemia. haematol
92: 723-727
[Full Text]
Bacher, U., Haferlach, T., Kern, W., Haferlach, C., Schnittger, S.
(2007). A comparative study of molecular mutations in 381 patients with myelodysplastic syndrome and in 4130 patients with acute myeloid leukemia. haematol
92: 744-752
[Abstract][Full Text]
Li, J., Sejas, D. P., Burma, S., Chen, D. J., Pang, Q.
(2007). Nucleophosmin suppresses oncogene-induced apoptosis and senescence and enhances oncogenic cooperation in cells with genomic instability. Carcinogenesis
28: 1163-1170
[Abstract][Full Text]
Falini, B., Nicoletti, I., Bolli, N., Martelli, M. P., Liso, A., Gorello, P., Mandelli, F., Mecucci, C., Martelli, M. F.
(2007). Translocations and mutations involving the nucleophosmin (NPM1) gene in lymphomas and leukemias. haematol
92: 519-532
[Abstract][Full Text]
Meshinchi, S., Arceci, R. J.
(2007). Prognostic Factors and Risk-Based Therapy in Pediatric Acute Myeloid Leukemia. The Oncologist
12: 341-355
[Abstract][Full Text]
Falini, B., Nicoletti, I., Martelli, M. F., Mecucci, C.
(2007). Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood
109: 874-885
[Abstract][Full Text]
Lechertier, T., Sirri, V., Hernandez-Verdun, D., Roussel, P.
(2007). A B23-interacting sequence as a tool to visualize protein interactions in a cellular context. J. Cell Sci.
120: 265-275
[Abstract][Full Text]
Mrozek, K., Marcucci, G., Paschka, P., Whitman, S. P., Bloomfield, C. D.
(2007). Clinical relevance of mutations and gene-expression changes in adult acute myeloid leukemia with normal cytogenetics: are we ready for a prognostically prioritized molecular classification?. Blood
109: 431-448
[Abstract][Full Text]
Testa, U., Riccioni, R.
(2007). Deregulation of apoptosis in acute myeloid leukemia. haematol
92: 81-94
[Abstract][Full Text]
Suh, K. S., Crutchley, J. M., Koochek, A., Ryscavage, A., Bhat, K., Tanaka, T., Oshima, A., Fitzgerald, P., Yuspa, S. H.
(2007). Reciprocal Modifications of CLIC4 in Tumor Epithelium and Stroma Mark Malignant Progression of Multiple Human Cancers. Clin. Cancer Res.
13: 121-131
[Abstract][Full Text]
Pedersen-Bjergaard, J., Andersen, M. T., Andersen, M. K.
(2007). Genetic Pathways in the Pathogenesis of Therapy-Related Myelodysplasia and Acute Myeloid Leukemia. ASH Education Book
2007: 392-397
[Abstract][Full Text]
Dohner, H.
(2007). Implication of the Molecular Characterization of Acute Myeloid Leukemia. ASH Education Book
2007: 412-419
[Abstract][Full Text]
Grimwade, D.
(2006). NPM1 mutation in AML: WHO and why?. Blood
108: 3965-3965
[Full Text]
Pasqualucci, L., Liso, A., Martelli, M. P., Bolli, N., Pacini, R., Tabarrini, A., Carini, M., Bigerna, B., Pucciarini, A., Mannucci, R., Nicoletti, I., Tiacci, E., Meloni, G., Specchia, G., Cantore, N., Di Raimondo, F., Pileri, S., Mecucci, C., Mandelli, F., Martelli, M. F., Falini, B.
(2006). Mutated nucleophosmin detects clonal multilineage involvement in acute myeloid leukemia: impact on WHO classification. Blood
108: 4146-4155
[Abstract][Full Text]
Garcia, M. A., Gil, J., Ventoso, I., Guerra, S., Domingo, E., Rivas, C., Esteban, M.
(2006). Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action. Microbiol. Mol. Biol. Rev.
70: 1032-1060
[Abstract][Full Text]
Marzac, C., Teyssandier, I., Calendini, O., Perrot, J.-Y., Faussat, A.-M., Tang, R., Casadevall, N., Marie, J.-P., Legrand, O.
(2006). Flt3 Internal Tandem Duplication and P-Glycoprotein Functionality in 171 Patients with Acute Myeloid Leukemia. Clin. Cancer Res.
12: 7018-7024
[Abstract][Full Text]
Heuser, M., Beutel, G., Krauter, J., Dohner, K., von Neuhoff, N., Schlegelberger, B., Ganser, A.
(2006). High meningioma 1 (MN1) expression as a predictor for poor outcome in acute myeloid leukemia with normal cytogenetics. Blood
108: 3898-3905
[Abstract][Full Text]
Falini, B., Martelli, M. P., Bolli, N., Bonasso, R., Ghia, E., Pallotta, M. T., Diverio, D., Nicoletti, I., Pacini, R., Tabarrini, A., Galletti, B. V., Mannucci, R., Roti, G., Rosati, R., Specchia, G., Liso, A., Tiacci, E., Alcalay, M., Luzi, L., Volorio, S., Bernard, L., Guarini, A., Amadori, S., Mandelli, F., Pane, F., Lo-Coco, F., Saglio, G., Pelicci, P.-G., Martelli, M. F., Mecucci, C., for the GIMEMA Acute Leukemia Working Party,
(2006). Immunohistochemistry predicts nucleophosmin (NPM) mutations in acute myeloid leukemia. Blood
108: 1999-2005
[Abstract][Full Text]
Chen, W., Rassidakis, G. Z., Li, J., Routbort, M., Jones, D., Kantarjian, H., Medeiros, L. J., Bueso-Ramos, C. E
A correction has been published: N Engl J Med 2005;352(7):740.
(NPM-RAR
]); 129 patients with primary AML (including 70 with FAB subtype M3), and 135 with secondary AML who had not been participants in the GIMEMA study (details available from 
See NAPS document no. PC0002 for 17 pages of supplementary material. To order, contact NAPS, c/o Burrows Systems, P.O. Box 3976, New Hyde Park, NY 11040. 
Previous
