FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 352:786-792 February 24, 2005 Number 8 Next

Summary PDF PDA Full Text PowerPoint Slide Set Editorial by Dowell, J. E. Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited E-mail When Letters Appear PubMed Citation

SUMMARY

Mutations of the epidermal growth factor receptor (EGFR) gene have been identified in specimens from patients with non–small-cell lung cancer who have a response to anilinoquinazoline EGFR inhibitors. Despite the dramatic responses to such inhibitors, most patients ultimately have a relapse. The mechanism of the drug resistance is unknown. Here we report the case of a patient with EGFR-mutant, gefitinib-responsive, advanced non–small-cell lung cancer who had a relapse after two years of complete remission during treatment with gefitinib. The DNA sequence of the EGFR gene in his tumor biopsy specimen at relapse revealed the presence of a second point mutation, resulting in threonine-to-methionine amino acid change at position 790 of EGFR. Structural modeling and biochemical studies showed that this second mutation led to gefitinib resistance.

Responsiveness to these drugs is a characteristic of distinct subgroups of patients: women, patients who have never smoked, patients with adenocarcinoma, and Asians.⁸ In the majority of patients with highly responsive tumors, the tumor contains somatic mutations of the EGFR gene. These mutations are small deletions that affect amino acids 747 through 750 or point mutations (most commonly a replacement of leucine by arginine at codon 858 [L858R]).^9,10,11 These mutations mediate oncogenic effects by altering downstream signaling and antiapoptotic mechanisms.¹² Both types of mutation increase the sensitivity of the tumor to anilinoquinazoline inhibitors of EGFR, most likely by repositioning critical residues surrounding the ATP-binding cleft of the tyrosine kinase domain of the receptor, thereby stabilizing their interactions with both ATP and its competitive inhibitors.^9,10 Notwithstanding the success of these drugs in cases of non–small-cell lung cancer with activating EGFR mutations, it appears that all cases eventually progress despite such treatment.

Case Report

A 71-year-old former smoker was found to have advanced, moderately differentiated adenocarcinoma of the lung in May 2001. The diagnostic transbronchial tumor-biopsy specimen had a deletion, delL747–S752,¹³ identical to a previously described EGFR mutation that is associated with responsiveness to gefitinib. The disease progressed despite treatment with carboplatin, taxanes, and gemcitabine. However, the patient had a clinical and radiographic response to gefitinib monotherapy, which was started in August 2002.

After 24 months of complete remission, during which he continued to take gefitinib monotherapy, his symptoms worsened and computed tomography revealed progressive lung abnormalities consistent with the occurrence of a relapse. At this point, gefitinib was stopped, the patient provided written informed consent, and a transbronchial aspirate and transbronchial biopsy specimen were obtained. Both cytologic and pathological analysis confirmed the presence of recurrent, moderately differentiated adenocarcinoma (Figure 1A) against a background of normal tissue, with approximately 30 percent of the specimen made up of tumor cells. We hypothesized that the patient's relapse may have been due to an acquired, second mutation in the EGFR gene that conferred resistance to gefitinib, and therefore, we resequenced the EGFR tyrosine kinase domain in the second biopsy specimen. Since the relapse, the patient has been receiving various salvage therapies for advanced lung cancer.

View larger version (36K): [in this window] [in a new window]   Figure 1. Identification of a Second EGFR Mutation. Panel A shows the patient's transbronchial biopsy specimen obtained at the time of relapse. Nests of moderately differentiated adenocarcinoma cells (arrow) are intermixed with normal stromal and epithelial elements. In Panel B, sequencing of exon 20 demonstrates a novel C-to-T (antisense G-to-A) base-pair change (arrows). Raw sequences of the original biopsy specimen and the biopsy specimen obtained on relapse demonstrate the appearance of this mutation, and further subcloning confirms the presence of both the wild-type and mutant sequences.

 
Methods

Sequencing of the EGFR Gene

Genomic DNA was extracted from both tumor specimens from the patient, and exons 18 through 21 (the area of the EGFR gene coding for the tyrosine kinase domain) were amplified and sequenced as previously described.⁹ Sense and antisense sequences were obtained from the products of the same amplification reactions. All polymerase-chain-reaction (PCR) assays were repeated twice. The presence of the second mutation was confirmed by isolating RNA from the tumor specimen and sequencing the resultant complementary DNA (cDNA). Total RNA was extracted from paraffin-embedded tumor samples with the use of an RNA isolation kit (Optimum FFPE, Ambion Diagnostics). Then, 800 ng of total RNA was subjected to reverse-transcription PCR with random hexamer primers. Amplification of the cDNA (sense primer: 5'GTTAAAATTCCCGTCGCTATC3', and antisense primer: 5'GGACATAGTCCAGGAGGCAG3') yielded two fragments, a 196-bp (wild-type) fragment and a 178-bp (deletion product) fragment. PCR products were subcloned into the pGEM-T easy cloning vector (Invitrogen) and sequenced.

EGFR Expression Constructs

Constructs with the full-length wild-type EGFR, as well as the common mutations L858R and delL747–P753insS, were kindly provided by Dr. Kwok-Kin Wong. The delL747–S752 mutation (the initial EGFR mutation identified in our patient) and a second mutation in which methionine was substituted for threonine at position 790 (T790M — the second EGFR mutation identified in our patient) were introduced by means of a site-directed mutagenesis kit (QuikChange XL, Stratagene). All fragments containing point mutations or deletions, or both, were swapped with the corresponding sequence in wild-type EGFR that had been subcloned into plasmid DNA (pcDNA3.1). A hemagglutinin tag was added to the 3' end of the EGFR coding region. The resulting constructs were confirmed by sequencing.

Transfection and Western Blotting

For transient-transfection experiments, COS-7 or NIH-3T3 cells were plated at a concentration of 5x10⁴ cells per well in six-well plates. The following day, these cells were transfected with 1 µg of the expression constructs with the use of Fugene 6 (Roche), incubated for 12 hours in serum, and then incubated in serum-free medium for an additional 12 hours. The cells were then stimulated with 100 ng of epidermal growth factor (EGF) per milliliter for 15 minutes (Sigma). To determine whether the mutant receptors were inhibited by gefitinib (AstraZeneca), AG1478 (Calbiochem), cetuximab (commercial supply), erlotinib (commercial supply), or CL-387,785 (Calbiochem), each drug was added to the culture medium three hours before the addition of EGF. Whole-cell extracts were separated on 8 percent sodium dodecyl sulfate–polyacrylamide gels, transferred to nitrocellulose or polyvinylidine difluoride membranes, and analyzed with the use of a chemiluminescence reagent (Western Lightning, PerkinElmer Life Science). Autophosphorylation of EGFR was detected with antibody against phosphotyrosine at position 1068 (1:1000 dilution; Cell Signaling Technology), and total protein expression was measured with the use of antibody against EGFR (1:1000 dilution; Santa Cruz Biotechnology).

Structural Modeling

The crystallographic structure of the EGFR tyrosine kinase domain, solved in complex with erlotinib, was used as a model for the prediction of kinase-inhibitor binding (Protein Data Bank accession code 1M17 [PDB] ).¹⁴ The inhibitor and solvent were stripped from the model. We used the AutoDock program, version 3.0,¹⁵ to predict binding, first using a model of erlotinib, made by means of the JME molecular-editing feature of the online resource PRODRG.¹⁶ The erlotinib test yielded a model for ligand binding highly similar to that seen in the crystal structure. Using the AutoDockTools interface, we used a grid spacing of 0.375Å and 60x50x40 points centered around the catalytic cleft of the enzyme for docking and adopted the genetic algorithm with local search using default settings. Gefitinib and CL-387,785 were then docked with the use of the same protocol. To illustrate potential inhibitor clashes with the T790M mutant, we prepared figures in which threonine at position 790 (T790) is mutated to methionine. We then chose the lowest free-energy cluster that overlapped in the quinazoline moiety with the crystallographic coordinates found for erlotinib binding.

Results

Exons 18 through 21 of the EGFR gene were sequenced from DNA isolated from both the original diagnostic biopsy specimen and the biopsy specimen obtained at relapse. These exons encompass most of the tyrosine kinase binding domain of EGFR and all activating EGFR mutations described thus far. The original diagnostic biopsy specimen contained a small deletion mutation, delL747–S752, consistent with other, commonly identified EGFR mutations. Examination of the sequences of exon 19 confirmed the persistence of the original delL747–S752 mutation in the second biopsy specimen.

Comparison of the DNA sequences from the original diagnostic biopsy specimen and the second biopsy specimen demonstrated the presence of a new, double peak in exon 20, which was confirmed by re-amplification and sequencing in both sense and antisense directions (Figure 1B). The product of exon 20 amplification was subcloned, and multiple subclones were sequenced. Whereas 13 of 17 subclones demonstrated wild-type sequences, 4 contained an identical single base-pair change from cytosine to thymidine (C to T) (Figure 1B), confirming that the new peak was caused by a base-pair change at this position (position 164208; GenBank accession number AY588246 [GenBank] ).

To obtain further evidence of the presence of a second mutation, cDNA was generated from RNA isolated from the paraffin block of the biopsy specimen obtained at the time of relapse. The cDNA was amplified, and the C-to-T base-pair change was confirmed in 14 of 40 subclones. Interestingly, the C-to-T base-pair change was consistently observed with either wild-type or delL747–S752 sequences, suggesting that the mutation is either biallelic or that the tumor has two distinct populations of cells.

The C-to-T base-pair change is predicted to change threonine to methionine at position 790 (T790M) in the catalytic cleft of the EGFR tyrosine kinase domain. Structural modeling was performed on the basis of a cocrystallization model of the binding of erlotinib to the EGFR tyrosine kinase domain.¹⁴ Using the coordinates from this model, we found that T790 appears to be critical for the binding of erlotinib to EGFR and is in juxtaposition to the acetylene side chain of the aniline group (Figure 2A). Because the methionine substitution introduces a bulkier amino acid side chain than does threonine at this position, the resulting steric hindrance may interfere with the binding of erlotinib (Figure 2B). Moreover, high-affinity binding of erlotinib by means of water-mediated hydrogen bonding could not take place with the methionine side chain, whereas the hydroxyl group of T790 likely contributes to high-affinity binding of erlotinib.

View larger version (70K): [in this window] [in a new window]   Figure 2. Mechanism of Drug Resistance. Panel A shows the crystallographically determined binding of erlotinib to wild-type EGFR, whereas Panel B shows how the T790M mutation leads to steric hindrance of erlotinib binding owing to the presence of the bulkier methionine side chain (orange) in the ATP-kinase–binding pocket. Panel C shows the steric hindrance in the predicted complex of gefitinib and EGFR with the T790M mutation. Panel D shows the predicted binding of CL-387,785 to EGFR with the T790M mutation (structural change introduced by the T790M mutation shown in orange).

 
Although a crystal structure of the gefitinib–EGFR complex has not been published, a model of this complex suggested that, in a conformation similar to the erlotinib–EGFR complex, the chloride at the 3 position of the aniline group lies in juxtaposition to the T790 moiety. A T790M substitution is predicted to lead to a similar steric clash with the gefitinib molecule (Figure 2C). This amino acid change is not expected to interfere with ATP-binding itself and, therefore, is not expected to alter the activity of the kinase on ligand stimulation.

To confirm the functional effects predicted by our structural model, the T790M substitution was introduced into the sequence of the wild-type EGFR, delL747–P753insS mutant EGFR (a frequently identified deletion mutant), the L858R mutant EGFR (the most common point mutation), and the delL747–S752 mutant. We performed transient-transfection experiments in COS-7 and NIH-3T3 cells using all four construct pairs (original construct vs. original construct with the T790M mutation). All four construct pairs demonstrated identical levels of expression of total EGFR and phosphorylated EGFR (phosphorylated EGFR corresponds to activated EGFR tyrosine kinase), suggesting that the presence of the T790M mutation does not substantially alter the production, degradation, activation, or deactivation of the scaffold EGFR molecule. In contrast, when transiently transfected COS-7 cells were treated with increasing concentrations of gefitinib before EGF stimulation, the original constructs were fully inhibited at a concentration of 20 nM, whereas all four constructs carrying the T790M amino acid substitution demonstrated high-level resistance, with persistent generation of phosphorylated EGFR at concentrations of gefitinib as high as 2 µM (Figure 3A). Identical results were obtained in NIH-3T3 cells (data not shown).

View larger version (46K): [in this window] [in a new window]   Figure 3. Resistance of EGFR with the T790M Mutation to Gefitinib (Panel A) and Susceptibility of EGFR with the T790M Mutation to an Alternative Inhibitor (Panel B). Panel A shows the inhibition of the activation of EGFR by gefitinib. Autophosphorylation of wild-type EGFR (tyrosine at position 1068 [T1068]) is detected by immunoblots of whole-cell extracts isolated from transfected COS-7 cells after a three-hour incubation with various concentrations of gefitinib. On the left, four different constructs without the T790M mutation are shown in lanes 1 through 5 and four constructs with the T790M mutation are shown in lanes 6 through 10. Total EGFR expression is shown on the right (control). Panel B shows the inhibition of EGFR autophosphorylation by CL-387,785. In both panels, autophosphorylation of EGFR was detected with antibody against phosphotyrosine at position 1068 (1:1000 dilution; anti–p-EGFR), and total protein expression was measured with the use of antibody against EGFR (1:1000 dilution; anti-EGFR).

 
To determine whether the T790M mutation leads to resistance to EGFR inhibitors that have different molecular structures and mechanisms, we screened four commercially available EGFR inhibitors (AG1478, cetuximab, erlotinib, and CL-387,785) using cells that were transiently transfected with the delL747–S752 construct and the delL747–S752+ T790M construct. We consistently found that CL-387,785, a specific and irreversible anilinoquinazoline EGFR inhibitor,¹⁷ strongly inhibited EGF-induced phosphorylation of both the delL747–S752 construct (apparent 50 percent inhibitory concentration [IC₅₀] of 0.3 nM) and the delL747–S752+ T790 M double-mutant construct (apparent IC₅₀ of 3.0 nM) (Figure 3B). When tested with the double-mutant construct, the CL-387,785 inhibitor demonstrated 1/10th its potency against the delL747–S752 construct, whereas the other tested inhibitors were ineffective against the double-mutant construct (data not shown). A model was generated with CL-387,785 and EGFR (Figure 2D). The 3-bromine side chain in this model points away from T790, as opposed to its orientation with respect to erlotinib and gefitinib, thereby potentially reducing the steric hindrance to binding of the mutated protein. The sensitivity of the delL747–S752+T790M construct to CL-387,785 might be explained by either its altered binding to the kinase domain or its covalent binding to EGFR.

Discussion

We identified a novel, second mutation of the EGFR gene in a tumor with the delL747–S752 mutation of EGFR. The delL747–S752 mutation is associated with susceptibility of non–small-cell lung cancer to gefitinib, and in our patient, the tumor was highly responsive to the drug. After a two-year remission while still receiving gefitinib, however, the patient had a relapse, and analysis of a biopsy of the gefitinib-resistant tumor revealed a second mutation in the tyrosine kinase domain of EGFR. Insertion of this mutation into test cells rendered them resistant to gefitinib in vitro. The development of a second mutation in the EGFR gene that confers resistance to gefitinib suggests that the tumor cells remain dependent on an active EGFR pathway for their proliferation.

In chronic myeloid leukemia and gastrointestinal stromal tumors, the two main mechanisms of resistance to imatinib are point mutations or, less commonly, amplification of the BCR-ABL gene.^18,19,20 Knowledge of these mechanisms has led to the development of second-generation BCR-ABL inhibitors.²¹ Interestingly, one of the most common imatinib resistance mutations in BCR-ABL replaces threonine at position 315 (the amino acid structurally corresponding to T790 of EGFR) with isoleucine in the ABL tyrosine kinase domain (T315I), leading to a structural change very similar to that observed with EGFR T790M.¹⁸ In fact, on the basis of the structural similarity between ABL and EGFR tyrosine kinases, the T790M change has been introduced into wild-type EGFR; this altered EGFR has high-level resistance to anilinoquinazoline inhibitors.²² Daily oral administration of gefitinib at recommended doses results in mean steady-state plasma concentrations of 0.4 to 1.4 µM.²³ Since at these levels the T790M mutation still allows the activation of EGFR, the presence of such a mutation might result in clinical resistance.

Although the T315I substitution in BCR-ABL confers high-level resistance to all tested inhibitor compounds, the corresponding T790M mutation of EGFR does not seem to confer such universal resistance, given the fact that in the context of the delL747–S752 mutation, it can effectively be inhibited by CL-387,785. Our results should motivate the development of alternative EGFR inhibitors or inhibitors of downstream targets of EGFR such as phosphatidylinositol 3'-kinase or STAT5 for patients with EGFR-mutant tumors with acquired resistance to anilinoquinazoline inhibitors.

Our findings, and results in patients with chronic myeloid leukemia and gastrointestinal stromal tumors, suggest that when a relapse occurs in patients with anilinoquinazoline-responsive lung cancer with a drug-susceptibility mutation, the tumor cells will contain other mutations in EGFR that confer resistance to the drug. Our work also underscores the need to consider incorporating repeated biopsies into clinical studies of novel targeted therapies, such as those involving mutant tyrosine kinases. Such information may guide the selection of second-line EGFR-inhibitor therapy.

Supported by a Specialized Program of Research Excellence (SPORE) Grant in Lung Cancer (PA20-CA090578-01A1, to Drs. Johnson and Tenen) and a grant (1K12CA87723-01, to Dr. Jänne) from the National Institutes of Health. Dr. Halmos was supported by an American Association for Cancer Research/Cancer Research Foundation of America/AstraZeneca Young Investigator Award for Translational Lung Cancer Research as well as by a Flight Attendant Medical Research Institute Young Clinical Scientist Award. Dr. Kobayashi was supported by the Uehara Memorial Foundation. Dr. Boggon is an American Society of Hematology Basic Research Fellow.

We are indebted to Drs. Gang Huang and Hideyo Hirai for their scientific and technical advice, to Dr. Kwok-Kin Wong for his kind gift of EGFR constructs, and to Dr. D. Gary Gilliland as well as members of the Tenen laboratory for their helpful comments and suggestions.

Source Information

From the Division of Hematology/Oncology (S.K., T.D., D.G.T., B.H.) and the Department of Pathology (O.K.), Beth Israel Deaconess Medical Center, Harvard Medical School; the Departments of Cancer Biology (T.J.B., M.J.E.), Medical Oncology (P.A.J., B.E.J., M.M.), and Pathology (M.M.), Dana–Farber Cancer Institute, Harvard Medical School; the Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School (T.J.B., M.J.E.); and the Department of Medicine, Brigham and Women's Hospital, Harvard Medical School (P.A.J., B.E.J.) — all in Boston; and the Ireland Cancer Center, University Hospitals of Cleveland, Case School of Medicine, Cleveland (B.H.).

Address reprint requests to Dr. Tenen at the Harvard Institutes of Medicine, HIM-954, 77 Louis Pasteur Ave., Boston, MA 02215, or at dtenen{at}bidmc.harvard.edu.

References

1. Jemal A, Tiwari RC, Murray T, et al. Cancer statistics, 2004. CA Cancer J Clin 2004;54:8-29. [Free Full Text]
2. Schiller JH, Harrington D, Belani CP, et al. Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med 2002;346:92-98. [Free Full Text]
3. Scagliotti GV, De Marinis F, Rinaldi M, et al. Phase III randomized trial comparing three platinum-based doublets in advanced non-small-cell lung cancer. J Clin Oncol 2002;20:4285-4291. [Free Full Text]
4. Mendelsohn J, Baselga J. Status of epidermal growth factor receptor antagonists in the biology and treatment of cancer. J Clin Oncol 2003;21:2787-2799. [Free Full Text]
5. Fukuoka M, Yano S, Giaccone G, et al. Multi-institutional randomized phase II trial of gefitinib for previously treated patients with advanced non-small-cell lung cancer (the IDEAL 1 Trial). J Clin Oncol 2003;21:2237-2246. [Erratum, J Clin Oncol 2004;22:4811.] [Free Full Text]
6. Kris MG, Natale RB, Herbst RS, et al. Efficacy of gefitinib, an inhibitor of the epidermal growth factor receptor tyrosine kinase, in symptomatic patients with non-small cell lung cancer: a randomized trial. JAMA 2003;290:2149-2158. [Free Full Text]
7. Perez-Soler R, Chachoua A, Hammond LA, et al. Determinants of tumor response and survival with erlotinib in patients with non-small-cell lung cancer. J Clin Oncol 2004;22:3238-3247. [Free Full Text]
8. Miller VA, Kris MG, Shah N, et al. Bronchioloalveolar pathologic subtype and smoking history predict sensitivity to gefitinib in advanced non-small-cell lung cancer. J Clin Oncol 2004;22:1103-1109. [Free Full Text]
9. Lynch TJ, Bell DW, Sordella R, et al. Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med 2004;350:2129-2139. [Free Full Text]
10. Paez JG, Janne PA, Lee JC, et al. EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science 2004;304:1497-1500. [Free Full Text]
11. Pao W, Miller V, Zakowski M, et al. EGF receptor gene mutations are common in lung cancers from "never smokers" and are associated with sensitivity of tumors to gefitinib and erlotinib. Proc Natl Acad Sci U S A 2004;101:13306-13311. [Free Full Text]
12. Sordella R, Bell DW, Haber DA, Settleman J. Gefitinib-sensitizing EGFR mutations in lung cancer activate anti-apoptotic pathways. Science 2004;305:1163-1167. [Free Full Text]
13. Cho D, Kocher O, Tenen DG, et al. Unusual cases in multiple myeloma and a dramatic response in metastatic lung cancer: case 4: mutation of the epidermal growth factor receptor in an elderly man with advanced, gefitinib-responsive, non-small-cell lung cancer. J Clin Oncol 2005;23:235-237. [Free Full Text]
14. Stamos J, Sliwkowski MX, Eigenbrot C. Structure of the epidermal growth factor receptor kinase domain alone and in complex with a 4-anilinoquinazoline inhibitor. J Biol Chem 2002;277:46265-46272. [Free Full Text]
15. Morris GM, Goodsell DS, Halliday RS, et al. Automated docking using a Lamarckian genetic algorithm and empirical binding free energy function. J Comput Chem 1998;19:1639-1662. [CrossRef][ISI]
16. Schuettelkopf AW, van Aalten DMF. PRODRG: a tool for high-throughput crystallography of protein-ligand complexes. Acta Crystallogr D Biol Crystallogr 2004;60:1355-1363. [CrossRef][Medline]
17. Discafani CM, Carroll ML, Floyd MB Jr, et al. Irreversible inhibition of epidermal growth factor receptor tyrosine kinase with in vivo activity by N-[4-[(3-bromophenyl)amino]-6-quinazolinyl]-2-butynamide (CL-387,785). Biochem Pharmacol 1999;57:917-925. [CrossRef][ISI][Medline]
18. Gorre ME, Mohammed M, Ellwood K, et al. Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science 2001;293:876-880. [Free Full Text]
19. Chen LL, Trent JC, Wu EF, et al. A missense mutation in KIT kinase domain 1 correlates with imatinib resistance in gastrointestinal stromal tumors. Cancer Res 2004;64:5913-5919. [Free Full Text]
20. Azam M, Latek RR, Daley GQ. Mechanisms of autoinhibition and STI-571/imatinib resistance revealed by mutagenesis of BCR-ABL. Cell 2003;112:831-843. [CrossRef][ISI][Medline]
21. Shah NP, Tran C, Lee FY, Chen P, Norris D, Sawyers CL. Overriding imatinib resistance with a novel ABL kinase inhibitor. Science 2004;305:399-401. [Free Full Text]
22. Blencke S, Ullrich A, Daub H. Mutation of threonine 766 in the epidermal growth factor receptor reveals a hotspot for resistance formation against selective tyrosine kinase inhibitors. J Biol Chem 2003;278:15435-15440. [Free Full Text]
23. Albanell J, Rojo F, Averbuch S, et al. Pharmacodynamic studies of the epidermal growth factor receptor inhibitor ZD1839 in skin from cancer patients: histopathologic and molecular consequences of receptor inhibition. J Clin Oncol 2002;20:110-124. [Free Full Text]

Summary PDF PDA Full Text PowerPoint Slide Set Editorial by Dowell, J. E. Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited E-mail When Letters Appear PubMed Citation

Related Letters:

EGFR Mutation and Response of Lung Cancer to Gefitinib
Toyooka S., Kiura K., Mitsudomi T., Kobayashi S., Tenen D. G., Halmos B.
Extract | Full Text | PDF  
N Engl J Med 2005; 352:2136, May 19, 2005. Correspondence

This article has been cited by other articles:

• Engelman, J. A., Janne, P. A. (2008). Mechanisms of Acquired Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Non-Small Cell Lung Cancer. Clin. Cancer Res. 14: 2895-2899 [Abstract] [Full Text]  
• Llovet, J. M., Di Bisceglie, A. M., Bruix, J., Kramer, B. S., Lencioni, R., Zhu, A. X., Sherman, M., Schwartz, M., Lotze, M., Talwalkar, J., Gores, G. J., for the Panel of Experts in HCC-Design Clinical Tr, (2008). Design and Endpoints of Clinical Trials in Hepatocellular Carcinoma. JNCI J Natl Cancer Inst 0: djn134v1-711 [Abstract] [Full Text]  
• Zucali, P. A., Ruiz, M. G., Giovannetti, E., Destro, A., Varella-Garcia, M., Floor, K., Ceresoli, G. L., Rodriguez, J. A., Garassino, I., Comoglio, P., Roncalli, M., Santoro, A., Giaccone, G. (2008). Role of cMET expression in non-small-cell lung cancer patients treated with EGFR tyrosine kinase inhibitors. Ann Oncol 0: mdn240v1-mdn240 [Abstract] [Full Text]  
• Weinstein, I. B., Joe, A., Felsher, D. (2008). Oncogene Addiction. Cancer Res. 68: 3077-3080 [Abstract] [Full Text]  
• Hodkinson, P. S., MacKinnon, A., Sethi, T. (2008). Targeting Growth Factors in Lung Cancer. Chest 133: 1209-1216 [Abstract] [Full Text]  
• Wang, Y.-C., Kulp, S. K., Wang, D., Yang, C.-C., Sargeant, A. M., Hung, J.-H., Kashida, Y., Yamaguchi, M., Chang, G.-D., Chen, C.-S. (2008). Targeting Endoplasmic Reticulum Stress and Akt with OSU-03012 and Gefitinib or Erlotinib to Overcome Resistance to Epidermal Growth Factor Receptor Inhibitors. Cancer Res. 68: 2820-2830 [Abstract] [Full Text]  
• Trowe, T., Boukouvala, S., Calkins, K., Cutler, R. E. Jr., Fong, R., Funke, R., Gendreau, S. B., Kim, Y. D., Miller, N., Woolfrey, J. R., Vysotskaia, V., Yang, J. P., Gerritsen, M. E., Matthews, D. J., Lamb, P., Heuer, T. S. (2008). EXEL-7647 Inhibits Mutant Forms of ErbB2 Associated with Lapatinib Resistance and Neoplastic Transformation. Clin. Cancer Res. 14: 2465-2475 [Abstract] [Full Text]  
• Kumar, A., Petri, E. T., Halmos, B., Boggon, T. J. (2008). Structure and Clinical Relevance of the Epidermal Growth Factor Receptor in Human Cancer. JCO 26: 1742-1751 [Abstract] [Full Text]  
• Godin-Heymann, N., Ulkus, L., Brannigan, B. W., McDermott, U., Lamb, J., Maheswaran, S., Settleman, J., Haber, D. A. (2008). The T790M "gatekeeper" mutation in EGFR mediates resistance to low concentrations of an irreversible EGFR inhibitor. Molecular Cancer Therapeutics 7: 874-879 [Abstract] [Full Text]  
• Smith, G D, Chadwick, B E, Willmore-Payne, C, Bentz, J S (2008). Detection of epidermal growth factor receptor gene mutations in cytology specimens from patients with non-small cell lung cancer utilising high-resolution melting amplicon analysis. J. Clin. Pathol. 61: 487-493 [Abstract] [Full Text]  
• Torkamani, A., Schork, N. J. (2008). Prediction of Cancer Driver Mutations in Protein Kinases. Cancer Res. 68: 1675-1682 [Abstract] [Full Text]  
• Peipp, M., Schneider-Merck, T., Dechant, M., Beyer, T., Lammerts van Bueren, J. J., Bleeker, W. K., Parren, P. W. H. I., van de Winkel, J. G. J., Valerius, T. (2008). Tumor Cell Killing Mechanisms of Epidermal Growth Factor Receptor (EGFR) Antibodies Are Not Affected by Lung Cancer-Associated EGFR Kinase Mutations. J. Immunol. 180: 4338-4345 [Abstract] [Full Text]  
• Ciardiello, F., Tortora, G. (2008). EGFR Antagonists in Cancer Treatment. NEJM 358: 1160-1174 [Full Text]  
• Costa, D. B., Schumer, S. T., Tenen, D. G., Kobayashi, S. (2008). Differential Responses to Erlotinib in Epidermal Growth Factor Receptor (EGFR)-Mutated Lung Cancers With Acquired Resistance to Gefitinib Carrying the L747S or T790M Secondary Mutations. JCO 26: 1182-1184 [Full Text]  
• Cho, B. C., Kim, J. H. (2008). In Reply. JCO 26: 1184-1186 [Full Text]  
• Kim, H.-P., Han, S.-W., Kim, S.-H., Im, S.-A., Oh, D.-Y., Bang, Y.-J., Kim, T.-Y. (2008). Combined lapatinib and cetuximab enhance cytotoxicity against gefitinib-resistant lung cancer cells. Molecular Cancer Therapeutics 7: 607-615 [Abstract] [Full Text]  
• Burris, H. III, Rocha-Lima, C. (2008). New Therapeutic Directions for Advanced Pancreatic Cancer: Targeting the Epidermal Growth Factor and Vascular Endothelial Growth Factor Pathways. The Oncologist 13: 289-298 [Abstract] [Full Text]  
• Yun, C.-H., Mengwasser, K. E., Toms, A. V., Woo, M. S., Greulich, H., Wong, K.-K., Meyerson, M., Eck, M. J. (2008). The T790M mutation in EGFR kinase causes drug resistance by increasing the affinity for ATP. Proc. Natl. Acad. Sci. USA 105: 2070-2075 [Abstract] [Full Text]  
• Cavazzoni, A., Alfieri, R. R., Carmi, C., Zuliani, V., Galetti, M., Fumarola, C., Frazzi, R., Bonelli, M., Bordi, F., Lodola, A., Mor, M., Petronini, P. G. (2008). Dual mechanisms of action of the 5-benzylidene-hydantoin UPR1024 on lung cancer cell lines. Molecular Cancer Therapeutics 7: 361-370 [Abstract] [Full Text]  
• MacLaine, N. J., Wood, M. D., Holder, J. C., Rees, R. W., Southgate, J. (2008). Sensitivity of Normal, Paramalignant, and Malignant Human Urothelial Cells to Inhibitors of the Epidermal Growth Factor Receptor Signaling Pathway. Mol Cancer Res 6: 53-63 [Abstract] [Full Text]  
• Bean, J., Brennan, C., Shih, J.-Y., Riely, G., Viale, A., Wang, L., Chitale, D., Motoi, N., Szoke, J., Broderick, S., Balak, M., Chang, W.-C., Yu, C.-J., Gazdar, A., Pass, H., Rusch, V., Gerald, W., Huang, S.-F., Yang, P.-C., Miller, V., Ladanyi, M., Yang, C.-H., Pao, W. (2007). MET amplification occurs with or without T790M mutations in EGFR mutant lung tumors with acquired resistance to gefitinib or erlotinib. Proc. Natl. Acad. Sci. USA 104: 20932-20937 [Abstract] [Full Text]  
• Deng, J., Shimamura, T., Perera, S., Carlson, N. E., Cai, D., Shapiro, G. I., Wong, K.-K., Letai, A. (2007). Proapoptotic BH3-Only BCL-2 Family Protein BIM Connects Death Signaling from Epidermal Growth Factor Receptor Inhibition to the Mitochondrion. Cancer Res. 67: 11867-11875 [Abstract] [Full Text]  
• Engelman, J. A., Zejnullahu, K., Gale, C.-M., Lifshits, E., Gonzales, A. J., Shimamura, T., Zhao, F., Vincent, P. W., Naumov, G. N., Bradner, J. E., Althaus, I. W., Gandhi, L., Shapiro, G. I., Nelson, J. M., Heymach, J. V., Meyerson, M., Wong, K.-K., Janne, P. A. (2007). PF00299804, an Irreversible Pan-ERBB Inhibitor, Is Effective in Lung Cancer Models with EGFR and ERBB2 Mutations that Are Resistant to Gefitinib. Cancer Res. 67: 11924-11932 [Abstract] [Full Text]  
• Yu, Z., Boggon, T. J., Kobayashi, S., Jin, C., Ma, P. C., Dowlati, A., Kern, J. A., Tenen, D. G., Halmos, B. (2007). Resistance to an Irreversible Epidermal Growth Factor Receptor (EGFR) Inhibitor in EGFR-Mutant Lung Cancer Reveals Novel Treatment Strategies. Cancer Res. 67: 10417-10427 [Abstract] [Full Text]  
• Raz, T., Nardi, V., Azam, M., Cortes, J., Daley, G. Q. (2007). Farnesyl transferase inhibitor resistance probed by target mutagenesis. Blood 110: 2102-2109 [Abstract] [Full Text]  
• Janne, P. A., von Pawel, J., Cohen, R. B., Crino, L., Butts, C. A., Olson, S. S., Eiseman, I. A., Chiappori, A. A., Yeap, B. Y., Lenehan, P. F., Dasse, K., Sheeran, M., Bonomi, P. D. (2007). Multicenter, Randomized, Phase II Trial of CI-1033, an Irreversible Pan-ERBB Inhibitor, for Previously Treated Advanced Non Small-Cell Lung Cancer. JCO 25: 3936-3944 [Abstract] [Full Text]  
• Edwards, A., Li, J., Atadja, P., Bhalla, K., Haura, E. B. (2007). Effect of the histone deacetylase inhibitor LBH589 against epidermal growth factor receptor dependent human lung cancer cells. Molecular Cancer Therapeutics 6: 2515-2524 [Abstract] [Full Text]  
• Riely, G. J., Kris, M. G., Zhao, B., Akhurst, T., Milton, D. T., Moore, E., Tyson, L., Pao, W., Rizvi, N. A., Schwartz, L. H., Miller, V. A. (2007). Prospective Assessment of Discontinuation and Reinitiation of Erlotinib or Gefitinib in Patients with Acquired Resistance to Erlotinib or Gefitinib Followed by the Addition of Everolimus. Clin. Cancer Res. 13: 5150-5155 [Abstract] [Full Text]  
• Ogino, A., Kitao, H., Hirano, S., Uchida, A., Ishiai, M., Kozuki, T., Takigawa, N., Takata, M., Kiura, K., Tanimoto, M. (2007). Emergence of Epidermal Growth Factor Receptor T790M Mutation during Chronic Exposure to Gefitinib in a Non Small Cell Lung Cancer Cell Line. Cancer Res. 67: 7807-7814 [Abstract] [Full Text]  
• Franovic, A., Gunaratnam, L., Smith, K., Robert, I., Patten, D., Lee, S. (2007). Translational up-regulation of the EGFR by tumor hypoxia provides a nonmutational explanation for its overexpression in human cancer. Proc. Natl. Acad. Sci. USA 104: 13092-13097 [Abstract] [Full Text]  
• Godin-Heymann, N., Bryant, I., Rivera, M. N., Ulkus, L., Bell, D. W., Riese, D. J. II, Settleman, J., Haber, D. A. (2007). Oncogenic Activity of Epidermal Growth Factor Receptor Kinase Mutant Alleles Is Enhanced by the T790M Drug Resistance Mutation. Cancer Res. 67: 7319-7326 [Abstract] [Full Text]  
• Nakajima, T., Yasufuku, K., Suzuki, M., Hiroshima, K., Kubo, R., Mohammed, S., Miyagi, Y., Matsukuma, S., Sekine, Y., Fujisawa, T. (2007). Assessment of Epidermal Growth Factor Receptor Mutation by Endobronchial Ultrasound-Guided Transbronchial Needle Aspiration. Chest 132: 597-602 [Abstract] [Full Text]  
• Wong, K.-K. (2007). HKI-272 in Non Small Cell Lung Cancer. Clin. Cancer Res. 13: 4593s-4596s [Abstract] [Full Text]  
• Little, S. E., Bax, D. A., Rodriguez-Pinilla, M., Natrajan, R., Messahel, B., Pritchard-Jones, K., Vujanic, G. M., Reis-Filho, J. S., Jones, C. (2007). Multifaceted Dysregulation of the Epidermal Growth Factor Receptor Pathway in Clear Cell Sarcoma of the Kidney. Clin. Cancer Res. 13: 4360-4364 [Abstract] [Full Text]  
• Karamouzis, M. V., Grandis, J. R., Argiris, A. (2007). Therapies Directed Against Epidermal Growth Factor Receptor in Aerodigestive Carcinomas. JAMA 298: 70-82 [Abstract] [Full Text]  
• Chiang, C.-T., Way, T.-D., Lin, J.-K. (2007). Sensitizing HER2-overexpressing cancer cells to luteolin-induced apoptosis through suppressing p21WAF1/CIP1 expression with rapamycin. Molecular Cancer Therapeutics 6: 2127-2138 [Abstract] [Full Text]  
• Gridelli, C., Bareschino, M. A., Schettino, C., Rossi, A., Maione, P., Ciardiello, F. (2007). Erlotinib in Non-Small Cell Lung Cancer Treatment: Current Status and Future Development. The Oncologist 12: 840-849 [Abstract] [Full Text]  
• Bunn, P. A. Jr (2007). Can Acquired Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors Be Overcome by Different Small-Molecule Tyrosine Kinase Inhibitors?. JCO 25: 2504-2505 [Full Text]  
• Cho, B. C., Im, C.-K., Park, M.-S., Kim, S. K., Chang, J., Park, J. P., Choi, H. J., Kim, Y. J., Shin, S.-J., Sohn, J. H., Kim, H., Kim, J. H. (2007). Phase II Study of Erlotinib in Advanced Non-Small-Cell Lung Cancer After Failure of Gefitinib. JCO 25: 2528-2533 [Abstract] [Full Text]  
• Yamasaki, F., Johansen, M. J., Zhang, D., Krishnamurthy, S., Felix, E., Bartholomeusz, C., Aguilar, R. J., Kurisu, K., Mills, G. B., Hortobagyi, G. N., Ueno, N. T. (2007). Acquired Resistance to Erlotinib in A-431 Epidermoid Cancer Cells Requires Down-regulation of MMAC1/PTEN and Up-regulation of Phosphorylated Akt. Cancer Res. 67: 5779-5788 [Abstract] [Full Text]  
• Li, J., Berbeco, R., Distel, R. J., Janne, P. A., Wang, L., Makrigiorgos, G. M. (2007). s-RT-MELT for rapid mutation scanning using enzymatic selection and real time DNA-melting: new potential for multiplex genetic analysis. Nucleic Acids Res 35: e84-e84 [Abstract] [Full Text]  
• Cappuzzo, F., Ligorio, C., Janne, P. A., Toschi, L., Rossi, E., Trisolini, R., Paioli, D., Holmes, A. J., Magrini, E., Finocchiaro, G., Bartolini, S., Cancellieri, A., Ciardiello, F., Patelli, M., Crino, L., Varella-Garcia, M. (2007). Prospective Study of Gefitinib in Epidermal Growth Factor Receptor Fluorescence In Situ Hybridization-Positive/Phospho-Akt-Positive or Never Smoker Patients With Advanced Non-Small-Cell Lung Cancer: The ONCOBELL Trial. JCO 25: 2248-2255 [Abstract] [Full Text]  
• Horiike, A., Kimura, H., Nishio, K., Ohyanagi, F., Satoh, Y., Okumura, S., Ishikawa, Y., Nakagawa, K., Horai, T., Nishio, M. (2007). Detection of Epidermal Growth Factor Receptor Mutation in Transbronchial Needle Aspirates of Non-Small Cell Lung Cancer. Chest 131: 1628-1634 [Abstract] [Full Text]  
• Li, T., Ling, Y.-H., Goldman, I. D., Perez-Soler, R. (2007). Schedule-Dependent Cytotoxic Synergism of Pemetrexed and Erlotinib in Human Non-Small Cell Lung Cancer Cells. Clin. Cancer Res. 13: 3413-3422 [Abstract] [Full Text]  
• Toyooka, S., Date, H., Uchida, A., Kiura, K., Takata, M. (2007). The Epidermal Growth Factor Receptor D761Y Mutation and Effect of Tyrosine Kinase Inhibitor. Clin. Cancer Res. 13: 3431-3431 [Full Text]  
• Ray, A., Cowan-Jacob, S. W., Manley, P. W., Mestan, J., Griffin, J. D. (2007). Identification of BCR-ABL point mutations conferring resistance to the Abl kinase inhibitor AMN107 (nilotinib) by a random mutagenesis study. Blood 109: 5011-5015 [Abstract] [Full Text]  
• Vikis, H., Sato, M., James, M., Wang, D., Wang, Y., Wang, M., Jia, D., Liu, Y., Bailey-Wilson, J. E., Amos, C. I., Pinney, S. M., Petersen, G. M., de Andrade, M., Yang, P., Wiest, J. S., Fain, P. R., Schwartz, A. G., Gazdar, A., Gaba, C., Rothschild, H., Mandal, D., Kupert, E., Seminara, D., Viswanathan, A., Govindan, R., Minna, J., Anderson, M. W., You, M. (2007). EGFR-T790M Is a Rare Lung Cancer Susceptibility Allele with Enhanced Kinase Activity. Cancer Res. 67: 4665-4670 [Abstract] [Full Text]  
• Greshock, J., Nathanson, K., Martin, A.-M., Zhang, L., Coukos, G., Weber, B. L., Zaks, T. Z. (2007). Cancer Cell Lines as Genetic Models of Their Parent Histology: Analyses Based on Array Comparative Genomic Hybridization. Cancer Res. 67: 3594-3600 [Abstract] [Full Text]  
• Hirsch, F., Varella-Garcia, M, Cappuzzo, F, McCoy, J, Bemis, L, Xavier, A., Dziadziuszko, R, Gumerlock, P, Chansky, K, West, H, Gazdar, A., Crino, L, Gandara, D., Franklin, W., Bunn, P. Jr (2007). Combination of EGFR gene copy number and protein expression predicts outcome for advanced non-small-cell lung cancer patients treated with gefitinib. Ann Oncol 18: 752-760 [Abstract] [Full Text]  
• Fridman, J. S., Caulder, E., Hansbury, M., Liu, X., Yang, G., Wang, Q., Lo, Y., Zhou, B.-B., Pan, M., Thomas, S. M., Grandis, J. R., Zhuo, J., Yao, W., Newton, R. C., Friedman, S. M., Scherle, P. A., Vaddi, K. (2007). Selective Inhibition of ADAM Metalloproteases as a Novel Approach for Modulating ErbB Pathways in Cancer. Clin. Cancer Res. 13: 1892-1902 [Abstract] [Full Text]  
• Mulloy, R., Ferrand, A., Kim, Y., Sordella, R., Bell, D. W., Haber, D. A., Anderson, K. S., Settleman, J. (2007). Epidermal Growth Factor Receptor Mutants from Human Lung Cancers Exhibit Enhanced Catalytic Activity and Increased Sensitivity to Gefitinib. Cancer Res. 67: 2325-2330 [Abstract] [Full Text]  
• Tabernero, J. (2007). The Role of VEGF and EGFR Inhibition: Implications for Combining Anti-VEGF and Anti-EGFR Agents. Mol Cancer Res 5: 203-220 [Abstract] [Full Text]  
• Steiner, P., Joynes, C., Bassi, R., Wang, S., Tonra, J. R., Hadari, Y. R., Hicklin, D. J. (2007). Tumor Growth Inhibition with Cetuximab and Chemotherapy in Non-Small Cell Lung Cancer Xenografts Expressing Wild-type and Mutated Epidermal Growth Factor Receptor. Clin. Cancer Res. 13: 1540-1551 [Abstract] [Full Text]  
• Zhang, X., Chang, A. (2007). Somatic mutations of the epidermal growth factor receptor and non-small-cell lung cancer. J. Med. Genet. 44: 166-172 [Abstract] [Full Text]  
• Sequist, L. V. (2007). Second-Generation Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors in Non-Small Cell Lung Cancer. The Oncologist 12: 325-330 [Abstract] [Full Text]  
• Subramanian, J., Govindan, R. (2007). Lung Cancer in Never Smokers: A Review. JCO 25: 561-570 [Abstract] [Full Text]  
• Sequist, L. V., Bell, D. W., Lynch, T. J., Haber, D. A. (2007). Molecular Predictors of Response to Epidermal Growth Factor Receptor Antagonists in Non-Small-Cell Lung Cancer. JCO 25: 587-595 [Abstract] [Full Text]  
• Karamouzis, M. V., Konstantinopoulos, P. A., Papavassiliou, A. G. (2007). The Activator Protein-1 Transcription Factor in Respiratory Epithelium Carcinogenesis. Mol Cancer Res 5: 109-120 [Abstract] [Full Text]  
• Wu, W., Onn, A., Isobe, T., Itasaka, S., Langley, R. R., Shitani, T., Shibuya, K., Komaki, R., Ryan, A. J., Fidler, I. J., Herbst, R. S., O'Reilly, M. S. (2007). Targeted therapy of orthotopic human lung cancer by combined vascular endothelial growth factor and epidermal growth factor receptor signaling blockade. Molecular Cancer Therapeutics 6: 471-483 [Abstract] [Full Text]  
• Schiffer, H. H., Reding, E. C., Fuhs, S. R., Lu, Q., Piu, F., Wong, S., Littler, P.-L. H., Weiner, D. M., Keefe, W., Tan, P. K., Nash, N. R., Knapp, A. E., Olsson, R., Brann, M. R. (2007). Pharmacology and Signaling Properties of Epidermal Growth Factor Receptor Isoforms Studied by Bioluminescence Resonance Energy Transfer. Mol. Pharmacol. 71: 508-518 [Abstract] [Full Text]  
• Toschi, L., Cappuzzo, F. (2007). Understanding the New Genetics of Responsiveness to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitors. The Oncologist 12: 211-220 [Abstract] [Full Text]  
• Mellinghoff, I. K., Cloughesy, T. F., Mischel, P. S. (2007). PTEN-Mediated Resistance to Epidermal Growth Factor Receptor Kinase Inhibitors. Clin. Cancer Res. 13: 378-381 [Abstract] [Full Text]  
• Chin, T. M., Anuar, D., Soo, R., Salto-Tellez, M., Li, W. Q., Ahmad, B., Lee, S. C., Goh, B. C., Kawakami, K., Segal, A., Iacopetta, B., Soong, R. (2007). Detection of Epidermal Growth Factor Receptor Variations by Partially Denaturing HPLC. Clin. Chem. 53: 62-70 [Abstract] [Full Text]  
• Sequist, L. V., Joshi, V. A., Janne, P. A., Muzikansky, A., Fidias, P., Meyerson, M., Haber, D. A., Kucherlapati, R., Johnson, B. E., Lynch, T. J. (2007). Response to treatment and survival of patients with non-small cell lung cancer undergoing somatic EGFR mutation testing.. The Oncologist 12: 90-98 [Abstract] [Full Text]  
• Perez-Torres, M., Guix, M., Gonzalez, A., Arteaga, C. L. (2006). Epidermal Growth Factor Receptor (EGFR) Antibody Down-regulates Mutant Receptors and Inhibits Tumors Expressing EGFR Mutations. J. Biol. Chem. 281: 40183-40192 [Abstract] [Full Text]  
• Skaggs, B. J., Gorre, M. E., Ryvkin, A., Burgess, M. R., Xie, Y., Han, Y., Komisopoulou, E., Brown, L. M., Loo, J. A., Landaw, E. M., Sawyers, C. L., Graeber, T. G. (2006). Phosphorylation of the ATP-binding loop directs oncogenicity of drug-resistant BCR-ABL mutants. Proc. Natl. Acad. Sci. USA 103: 19466-19471 [Abstract] [Full Text]  
• Rosell, R., Taron, M., Reguart, N., Isla, D., Moran, T. (2006). Epidermal Growth Factor Receptor Activation: How Exon 19 and 21 Mutations Changed Our Understanding of the Pathway. Clin. Cancer Res. 12: 7222-7231 [Abstract] [Full Text]  
• Riely, G. J., Politi, K. A., Miller, V. A., Pao, W. (2006). Update on Epidermal Growth Factor Receptor Mutations in Non-Small Cell Lung Cancer. Clin. Cancer Res. 12: 7232-7241 [Abstract] [Full Text]  
• Kobayashi, S., Shimamura, T., Monti, S., Steidl, U., Hetherington, C. J., Lowell, A. M., Golub, T., Meyerson, M., Tenen, D. G., Shapiro, G. I., Halmos, B. (2006). Transcriptional Profiling Identifies Cyclin D1 as a Critical Downstream Effector of Mutant Epidermal Growth Factor Receptor Signaling. Cancer Res. 66: 11389-11398 [Abstract] [Full Text]  
• Balak, M. N., Gong, Y., Riely, G. J., Somwar, R., Li, A. R., Zakowski, M. F., Chiang, A., Yang, G., Ouerfelli, O., Kris, M. G., Ladanyi, M., Miller, V. A., Pao, W. (2006). Novel D761Y and Common Secondary T790M Mutations in Epidermal Growth Factor Receptor-Mutant Lung Adenocarcinomas with Acquired Resistance to Kinase Inhibitors.. Clin. Cancer Res. 12: 6494-6501 [Abstract] [Full Text]  
• Milton, D. T., Riely, G. J., Pao, W., Miller, V. A., Kris, M. G., Heelan, R. T. (2006). Molecular On/Off Switch. JCO 24: 4940-4942 [Full Text]  
• Giaccone, G., Gallegos Ruiz, M., Le Chevalier, T., Thatcher, N., Smit, E., Rodriguez, J. A., Janne, P., Oulid-Aissa, D., Soria, J.-C. (2006). Erlotinib for Frontline Treatment of Advanced Non-Small Cell Lung Cancer: a Phase II Study.. Clin. Cancer Res. 12: 6049-6055 [Abstract] [Full Text]  
• Das, A. K., Sato, M., Story, M. D., Peyton, M., Graves, R., Redpath, S., Girard, L., Gazdar, A. F., Shay, J. W., Minna, J. D., Nirodi, C. S. (2006). Non-Small Cell Lung Cancers with Kinase Domain Mutations in the Epidermal Growth Factor Receptor Are Sensitive to Ionizing Radiation. Cancer Res. 66: 9601-9608 [Abstract] [Full Text]  
• Krueger, K. E., Srivastava, S. (2006). Posttranslational Protein Modifications: Current Implications for Cancer Detection, Prevention, and Therapeutics. Mol. Cell. Proteomics 5: 1799-1810 [Full Text]  
• Kosaka, T., Yatabe, Y., Endoh, H., Yoshida, K., Hida, T., Tsuboi, M., Tada, H., Kuwano, H., Mitsudomi, T. (2006). Analysis of epidermal growth factor receptor gene mutation in patients with non-small cell lung cancer and acquired resistance to gefitinib.. Clin. Cancer Res. 12: 5764-5769 [Abstract] [Full Text]  
• Amicarelli, G., Adlerstein, D., Shehi, E., Wang, F., Makrigiorgos, G. M. (2006). Genotype-Specific Signal Generation Based on Digestion of 3-Way DNA Junctions: Application to KRAS Variation Detection. Clin. Chem. 52: 1855-1863 [Abstract] [Full Text]  
• Jackman, D. M., Holmes, A. J., Lindeman, N., Wen, P. Y., Kesari, S., Borras, A. M., Bailey, C., de Jong, F., Janne, P. A., Johnson, B. E. (2006). Response and Resistance in a Non-Small-Cell Lung Cancer Patient With an Epidermal Growth Factor Receptor Mutation and Leptomeningeal Metastases Treated With High-Dose Gefitinib. JCO 24: 4517-4520 [Full Text]  
• Inukai, M., Toyooka, S., Ito, S., Asano, H., Ichihara, S., Soh, J., Suehisa, H., Ouchida, M., Aoe, K., Aoe, M., Kiura, K., Shimizu, N., Date, H. (2006). Presence of Epidermal Growth Factor Receptor Gene T790M Mutation as a Minor Clone in Non-Small Cell Lung Cancer. Cancer Res. 66: 7854-7858 [Abstract] [Full Text]  
• von Bubnoff, N., Manley, P. W., Mestan, J., Sanger, J., Peschel, C., Duyster, J. (2006). Bcr-Abl resistance screening predicts a limited spectrum of point mutations to be associated with clinical resistance to the Abl kinase inhibitor nilotinib (AMN107). Blood 108: 1328-1333 [Abstract] [Full Text]  
• Chou, W.-C., Huang, S.-F., Yeh, K.-Y., Wang, H.-M., Liu, M.-Y., Hsieh, J.-J., Cheung, Y.-C., Chang, J. W.-C. (2006). Different Responses to Gefitinib in Lung Adenocarcinoma Coexpressing Mutant- and Wild-Type Epidermal Growth Factor Receptor Genes. Jpn J Clin Oncol 36: 523-526 [Abstract] [Full Text]  
• Coldren, C. D., Helfrich, B. A., Witta, S. E., Sugita, M., Lapadat, R., Zeng, C., Baron, A., Franklin, W. A., Hirsch, F. R., Geraci, M. W., Bunn, P. A. Jr. (2006). Baseline Gene Expression Predicts Sensitivity to Gefitinib in Non-Small Cell Lung Cancer Cell Lines. Mol Cancer Res 4: 521-528 [Abstract] [Full Text]  
• Janne, P. A. (2006). Gefitinib for Epidermal Growth Factor Receptor Mutant Lung Cancers: Searching for a Weapon of Mass Destruction. JCO 24: 3319-3321 [Full Text]  
• Kwak, E. L., Jankowski, J., Thayer, S. P., Lauwers, G. Y., Brannigan, B. W., Harris, P. L., Okimoto, R. A., Haserlat, S. M., Driscoll, D. R., Ferry, D., Muir, B., Settleman, J., Fuchs, C. S., Kulke, M. H., Ryan, D. P., Clark, J. W., Sgroi, D. C., Haber, D. A., Bell, D. W. (2006). Epidermal growth factor receptor kinase domain mutations in esophageal and pancreatic adenocarcinomas.. Clin. Cancer Res. 12: 4283-4287 [Abstract] [Full Text]  
• Engelman, J. A., Cantley, L. C. (2006). The Role of the ErbB Family Members in Non-Small Cell "Lung Cancers Sensitive to Epidermal Growth Factor Receptor Kinase Inhibitors".. Clin. Cancer Res. 12: 4372s-4376s [Abstract] [Full Text]  
• Thomas, R. K., Weir, B., Meyerson, M. (2006). Genomic approaches to lung cancer.. Clin. Cancer Res. 12: 4384s-4391s [Abstract] [Full Text]  
• Sequist, L. V., Joshi, V. A., Janne, P. A., Bell, D. W., Fidias, P., Lindeman, N. I., Louis, D. N., Lee, J. C., Mark, E. J., Longtine, J., Verlander, P., Kucherlapati, R., Meyerson, M., Haber, D. A., Johnson, B. E., Lynch, T. J. (2006). Epidermal growth factor receptor mutation testing in the care of lung cancer patients.. Clin. Cancer Res. 12: 4403s-4408s [Abstract] [Full Text]  
• Janne, P. A., Johnson, B. E. (2006). Effect of epidermal growth factor receptor tyrosine kinase domain mutations on the outcome of patients with non-small cell lung cancer treated with epidermal growth factor receptor tyrosine kinase inhibitors.. Clin. Cancer Res. 12: 4416s-4420s [Abstract] [Full Text]  
• Heymach, J. V., Nilsson, M., Blumenschein, G., Papadimitrakopoulou, V., Herbst, R. (2006). Epidermal growth factor receptor inhibitors in development for the treatment of non-small cell lung cancer.. Clin. Cancer Res. 12: 4441s-4445s [Abstract] [Full Text]  
• Yatabe, Y., Hida, T., Horio, Y., Kosaka, T., Takahashi, T., Mitsudomi, T. (2006). A Rapid, Sensitive Assay to Detect EGFR Mutation in Small Biopsy Specimens from Lung Cancer. J. Mol. Diagn. 8: 335-341 [Abstract] [Full Text]  
• Shimamura, T., Ji, H., Minami, Y., Thomas, R. K., Lowell, A. M., Shah, K., Greulich, H., Glatt, K. A., Meyerson, M., Shapiro, G. I., Wong, K.-K. (2006). Non-Small-Cell Lung Cancer and Ba/F3 Transformed Cells Harboring the ERBB2 G776insV_G/C Mutation Are Sensitive to the Dual-Specific Epidermal Growth Factor Receptor and ERBB2 Inhibitor HKI-272.. Cancer Res. 66: 6487-6491 [Abstract] [Full Text]  
• Cappuzzo, F., Toschi, L., Tallini, G., Ceresoli, G. L., Domenichini, I., Bartolini, S., Finocchiaro, G., Magrini, E., Metro, G., Cancellieri, A., Trisolini, R., Crino, L., Bunn, P. A. Jr, Santoro, A., Franklin, W. A., Varella-Garcia, M., Hirsch, F. R. (2006). Insulin-like growth factor receptor 1 (IGFR-1) is significantly associated with longer survival in non-small-cell lung cancer patients treated with gefitinib. Ann Oncol 17: 1120-1127 [Abstract] [Full Text]  
• Bell, D. W., Haber, D. A. (2006). A Blood-Based Test for Epidermal Growth Factor Receptor Mutations in Lung Cancer.. Clin. Cancer Res. 12: 3875-3877 [Full Text]  
• Jackman, D. M., Yeap, B. Y., Sequist, L. V., Lindeman, N., Holmes, A. J., Joshi, V. A., Bell, D. W., Huberman, M. S., Halmos, B., Rabin, M. S., Haber, D. A., Lynch, T. J., Meyerson, M., Johnson, B. E., Janne, P. A. (2006). Exon 19 Deletion Mutations of Epidermal Growth Factor Receptor Are Associated with Prolonged Survival in Non-Small Cell Lung Cancer Patients Treated with Gefitinib or Erlotinib.. Clin. Cancer Res. 12: 3908-3914 [Abstract] [Full Text]  
• Kimura, H., Kasahara, K., Kawaishi, M., Kunitoh, H., Tamura, T., Holloway, B., Nishio, K. (2006). Detection of Epidermal Growth Factor Receptor Mutations in Serum as a Predictor of the Response to Gefitinib in Patients with Non-Small-Cell Lung Cancer.. Clin. Cancer Res. 12: 3915-3921 [Abstract] [Full Text]  
• Shah, N. P., Lee, F. Y., Luo, R., Jiang, Y., Donker, M., Akin, C. (2006). Dasatinib (BMS-354825) inhibits KITD816V, an imatinib-resistant activating mutation that triggers neoplastic growth in most patients with systemic mastocytosis. Blood 108: 286-291 [Abstract] [Full Text]