The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
Brief Report
PreviousPrevious
Volume 355:2752-2756 December 28, 2006 Number 26
NextNext

Human Trypanosoma evansi Infection Linked to a Lack of Apolipoprotein L-I
Benoit Vanhollebeke, Eng., Philippe Truc, Ph.D., Philippe Poelvoorde, M.Sc., Annette Pays, M.Sc., Prashant P. Joshi, M.D., Ravindra Katti, M.D., Jean G. Jannin, M.D., and Etienne Pays, Ph.D.

 

This Article
-Summary
- PDF
-PDA Full Text
-PowerPoint Slide Set

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited
-E-mail When Letters Appear

More Information
-PubMed Citation
SUMMARY

Humans have innate immunity against Trypanosoma brucei brucei that is known to involve apolipoprotein L-I (APOL1). Recently, a case of T. evansi infection in a human was identified in India. We investigated whether the APOL1 pathway was involved in this occurrence. The serum of the infected patient was found to have no trypanolytic activity, and the finding was linked to the lack of APOL1, which was due to frameshift mutations in both APOL1 alleles. Trypanolytic activity was restored by the addition of recombinant APOL1. The lack of APOL1 explained the patient's infection with T. evansi.


Trypanosoma evansi is a widely distributed hemoflagellate parasite that affects domesticated mammals (e.g., horses, cattle, camels, and water buffalo). Since its adaptation to mechanical transmission by blood-sucking insects (tabanids), the parasite has spread beyond its original distribution in sub-Saharan Africa and is now also present in South America, North Africa, and large parts of Asia, including India. Normally, humans are resistant to infection with T. evansi, as well as to infection with the related African trypanosomes, the prototype of which is T. brucei brucei.1,2,3 Human innate immunity against T. brucei brucei is due to the trypanolytic activity of a human-specific apolipoprotein bound to high-density lipoproteins, termed apolipoprotein L-I (APOL1).4 This protein contains an ionic pore-forming domain consisting of nine alpha helixes, as well as an adjacent pH-sensitive membrane-addressing domain consisting of two alpha helixes.5 APOL1 is taken up in the parasite by endocytosis and triggers the formation of anion-selective pores in the lysosomal membrane, which induces the uncontrolled osmotic swelling of this compartment and subsequent cell death.5,6

The T. brucei subspecies T. brucei rhodesiense and T. brucei gambiense have acquired resistance to APOL1, which enables these parasites to infect humans and cause sleeping sickness. In T. brucei rhodesiense, resistance to normal human serum is conferred by a single protein, termed serum resistance–associated protein (SRA), which interacts strongly and specifically with APOL1.4,7 SRA was found to provide specific resistance to T. brucei rhodesiense.7,8 The mechanism of resistance of T. brucei gambiense to APOL1 is not understood.6 T. evansi is normally sensitive to normal human serum2,3; therefore, it had not been known to cause human disease until recently, when it was found to have infected a human in the Maharashtra state of India.9,10 The patient was an Indian cattle farmer who presented with a 5-month history of fluctuating trypanosome parasitemia associated with febrile episodes. Findings on morphologic examination of the parasites, as well as serologic and molecular tests — in particular the presence of typical kinetoplast-DNA minicircles of type A — identified the infecting species as T. evansi.9,11 The patient was treated with suramin, which led to a complete cure.10 SRA was not detected in these parasites.11 We report results of the analysis of the trypanolytic activity in the serum of the infected person; our analysis allowed us to propose an explanation as to why he became infected.

Methods

We obtained the T. evansi reference strains Zagora 1.17 and Vietnam-WH, taken from a camel in Morocco and a water buffalo in Vietnam, respectively, from the Institute of Tropical Medicine, in Antwerp, Belgium. The parasites isolated from the Indian patient, with his consent, could not be grown in vitro or in rodents, which prevented their physiological analysis. Genetic analyses showed that these parasites have a close relationship with the Vietnam-WH isolate.11

Trypanolysis assays were conducted using 2x105 trypanosomes per milliliter from the T. evansi Zagora 1.17 and Vietnam-WH strains or the T. brucei brucei EATRO1125 strain, isolated from mice and incubated in HMI-9 medium12 containing various concentrations of serum. After 24 hours, living trypanosomes were counted three times by the same person. The experiment was conducted three times. To identify serum components interacting with SRA, recombinant His6-tagged SRA (10 µg) was incubated with 50 µl of serum for 4 hours at 4°C in 0.6 M sodium chloride, 0.35% CHAPS, and 0.15 M MES buffer (pH 5.8). The mixture was then incubated for 30 minutes at 4°C with 10 µl Ni–NTA (nickel-charged agarose) beads (Qiagen). Bound material was eluted with 250 mM imidazole. Western blots were incubated overnight at 4°C with a 1:100 dilution of a goat polyclonal monospecific anti–APOL1 antibody (Santa Cruz Biotechnology) in 150 mM sodium chloride, 0.5% (weight per volume) Tween 20, and 20 mM TRIS–hydrochloric acid (pH 7.5) with 1% nonfat milk. The bound antibodies were detected using peroxidase-conjugated mouse anti-goat IgG.

Genomic DNA was extracted from peripheral blood cells. The following five primer sets were used to amplify the APOL1 coding sequences from 100 ng genomic DNA: 5'CCATCCTGGCTAACATGGTGAAACC3' and 5'GTTAGCCTCAACTAGGATACAGCGG3'; 5'TCTGTAATGATCAGATGGCTGCCCG3' and 5'AGGTGCCACCCTCCATTCTAAGTGC3'; 5'AACAAGTCCCACATCACAGCTGTCC3' and 5'AAAGTTCCCATCACCAGCAGATGGC3'; 5'AGCCACCACACCGAGCCAAAACTGC3' and 5'AGCACAAGAAAGAAGCTTACAGGGG3'; and 5'AGGGTTAATGAACCCAGCATCCTGG3' and 5'ATGGCCCCCAAAGCTTGGAAAGAGC3'. The polymerase chain reaction (PCR) products and seven cloned mutation-containing fragments from three independent PCRs were sequenced.

Recombinant APOL1 was purified using His6-tagged APOL1 expressed from pET21d vector in Escherichia coli after a 4-hour induction at 37°C with 1 mM isopropyl beta-D-thiogalactoside. After washing, inclusion bodies were dissolved in 6 M guanidium–hydrochloric acid and 50 mM phosphate buffer (pH 8.0) and incubated with Ni-NTA beads for 16 hours at 4°C.13 All washing steps occurred at pH 8.0. After elution and dialysis against 20 mM acetic acid, the protein was more than 96% pure, as determined by sodium dodecyl sulfate–polyacrylamide-gel electrophoresis (SDS-PAGE). The nucleotide sequence GenBank accession number for these sequences will be publicly available with the release of dbSNP build 127 of the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov).

Results

The potential of the serum from the person with T. evansi infection to lyse T. evansi was evaluated in vitro. Two different parasite strains, one from Morocco and one from Vietnam, were used. No lytic activity was observed, since the parasites had normal growth in this serum. Trypanolytic activity was shown in normal human serum after dilution by a factor of 100,000 (Figure 1). The serum from the person with T. evansi infection showed no lytic activity against T. brucei brucei (Figure 1).

Figure 1
View larger version (28K):
[in this window]
[in a new window]
Get Slide
 
Figure 1. Lack of Trypanolytic Activity in T. evansi–Infected Human Serum.

From each parasite isolate, 2x105 trypanosomes per milliliter were incubated with various serum concentrations. Physiologic amounts of purified recombinant APOL1 (10 µg per milliliter) were added in some instances. After 24 hours, living trypanosomes were counted three times. Error bars represent standard deviations from three independent experiments. T. brucei brucei + SRA is a transgenic T. brucei brucei line transfected with the SRA gene of T. brucei rhodesiense.7 FCS denotes fetal-calf serum, NHS normal human serum, and TeiHS T. evansi–infected human serum.

 
APOL1 is the known factor in normal human serum that kills T. brucei brucei.4,5,6 This protein is not present in nonhuman serum such as fetal-calf serum, but the addition of recombinant APOL1 is sufficient to render fetal-calf serum lytic for T. brucei brucei, except when the gene for the APOL1-neutralizing T. brucei rhodesiense protein SRA is transfected into this parasite7 (Figure 1). The presence of APOL1 in the serum from the person with T. evansi infection was analyzed by incubating Western blots with anti–APOL1 antibodies, using normal human serum as a control. To assess the presence of APOL1, these serum samples were subjected to affinity chromatography on SRA, since APOL1 is known to bind strongly and specifically to this protein.4 As compared with normal human serum, T. evansi–infected human serum appeared to be largely devoid of APOL1 (by a factor of at least 125, as determined by densitometry) (Figure 2). A band weakly detected at approximately the expected size in unfractionated T. evansi–infected human serum was unlikely to be APOL1, because it did not bind to SRA and was also found in the SRA-unbound fraction of normal human serum (Figure 2A).

Figure 2
View larger version (21K):
[in this window]
[in a new window]
Get Slide
 
Figure 2. Lack of APOL1 in T. evansi–Infected Human Serum.

Normal human serum (NHS) and T. evansi–infected human serum (TeiHS) were subjected to affinity chromatography on serum resistance–associated protein (SRA), and equivalent volumes of total serum, unbound fraction, and bound fraction were analyzed by Western blotting with the use of anti–APOL1 antibodies (Panel A). Bound fractions of the indicated serum volumes were subjected to the same Western blot analysis (Panel B).

 
To determine the reason for the lack of APOL1 in serum from the person with T. evansi infection, DNA was extracted from his blood cells and PCR analysis was conducted with the use of five pairs of oligonucleotide primers that allowed the amplification of the complete APOL1 coding sequence. Two different mutations were detected with equal frequency in each of three independent PCR assays and are thus likely to characterize each allele (Figure 3A). For one allele, the absence of two bases resulted in a frameshift mutation from residue 142, leading to a premature stop at position 149, located in helix 5 of the pore-forming domain (Figure 3A and 3B). In the other allele, the absence of a single base resulted in a frameshift mutation from residue 266, located between the two alpha helixes of the membrane-addressing domain, leading to a premature stop at position 268 (Figure 3A and 3B). In both cases, the putative truncated proteins are predicted to be unable to trigger trypanolysis, because the simultaneous presence of intact pore-forming and membrane-addressing domains is required for this activity.5

Figure 3
View larger version (30K):
[in this window]
[in a new window]
Get Slide
 
Figure 3. Frameshift Mutations in the APOL1 Gene of the T. evansi–Infected Patient.

Panel A shows nucleotide and amino acid sequences at the frameshift mutations. The nucleotides deleted from the wild-type sequence are boxed, and the shifted mutant frames are in boldface type. Panel B shows the predicted amino acid sequences of wild-type and mutant APOL1 alleles. Red sequences represent the pore-forming domains and blue sequences the membrane-addressing domains of APOL1. The alpha helixes of each domain are underlined, and those of the pore-forming domain are numbered from {alpha}2 to {alpha}10 on the basis of sequence alignment with colicin A.5

 
The addition of normal levels of purified recombinant APOL1 to serum from the person with T. evansi infection was sufficient to restore its lytic potential (Figure 1). Therefore, the lack of APOL1 is responsible for the lack of trypanolytic activity of this serum.

Discussion

This case of human infection with T. evansi could be due either to acquired resistance to normal human serum by the parasite or to deficient trypanolytic activity of the host. T. evansi–infected human serum did not affect the two T. evansi strains (from Morocco and from Vietnam) that we tested. This serum was remarkably devoid of APOL1, a protein identified as a trypanolytic factor of normal human serum in the case of T. brucei brucei.4,5,6 The lack of APOL1 was due to the combination of two different frameshift mutations, one in each allele, which led to premature translational stops. The inability of T. evansi–infected human serum to kill T. evansi was probably due to this lack of APOL1, for the following reasons: this serum did not lyse T. brucei brucei, APOL1 is known to be the lytic factor of these parasites in normal human serum, and the addition of recombinant APOL1 restored the lytic potential of this serum.4,5,6 These data show that this case of T. evansi infection in a human is probably due to mutations in the APOL1 gene.

Supported by the Belgian Fonds National de la Recherche Scientifique (FNRS), the Special Program for Research and Training in Tropical Diseases (cosponsored by the United Nations Development Program, the World Bank, and the World Health Organization), and the Interuniversity Attraction Poles Program (managed by the Belgian Science Policy).

No potential conflict of interest relevant to this article was reported.


Source Information

From the Laboratory of Molecular Parasitology, Institut de Biologie et de Médecine Moléculaires, Université Libre de Bruxelles, Gosselies, Belgium (B.V., P.P., A.P., E.P.); the Institut de Recherche pour le Développement, Unité de Recherche 117 Trypanosomoses Africaines, Montpellier, France (P.T.); the Department of Medicine, Government Medical College, Nagpur, India (P.P.J.); the Directorate of Health Services, Mumbai, India (R.K.); and Communicable Diseases Control, Prevention and Eradication, World Health Organization, Geneva (J.G.J.).

Address reprint requests to Dr. Pays at the Laboratory of Molecular Parasitology, IBMM, Université Libre de Bruxelles, 12 rue des Professeurs Jeener et Brachet, B-6041 Gosselies, Belgium, or at epays{at}ulb.ac.be.

References

  1. Laveran A, Mesnil F. Trypanosomes et trypanosomiases. Paris: Masson et Cie, 1912:379. 
  2. Hawking F. The resistance of Trypanosoma congolense, T. vivax and T. evansi to human plasma. Trans R Soc Trop Med Hyg 1978;72:405-407. [CrossRef][ISI][Medline]
  3. Juyal PD, Singla LD, Saxena HM. In vivo activity of human serum against T. evansi infection in Swiss albino mice. J Parasitic Dis India 1998;22:67-8.
  4. Vanhamme L, Paturiaux-Hanocq F, Poelvoorde P, et al. Apolipoprotein L-I is the trypanosome lytic factor of human serum. Nature 2003;422:83-87. [CrossRef][Medline]
  5. Pérez-Morga D, Vanhollebeke B, Paturiaux-Hanocq F, et al. Apolipoprotein L-I promotes trypanosome lysis by forming pores in lysosomal membranes. Science 2005;309:469-472. [Free Full Text]
  6. Pays E, Vanhollebeke B, Vanhamme L, Paturiaux-Hanocq F, Nolan DP, Pérez-Morga D. The trypanolytic factor of human serum. Nat Rev Microbiol 2006;4:477-486. [CrossRef][ISI][Medline]
  7. Xong HV, Vanhamme L, Chamekh M, et al. A VSG expression site-associated gene confers resistance to human serum in Trypanosoma rhodesiense. Cell 1998;95:839-846. [CrossRef][ISI][Medline]
  8. Gibson WC. The SRA gene: the key to understanding the nature of Trypanosoma brucei rhodesiense. Parasitology 2005;131:143-150. [Medline]
  9. Joshi PP, Shegokar VR, Powar RM, et al. Human trypanosomiasis caused by Trypanosoma evansi in India: the first case report. Am J Trop Med Hyg 2005;73:491-495. [Free Full Text]
  10. Joshi PP, Chaudhari A, Shegokar VR, et al. Treatment and follow-up of the first case of human trypanosomiasis caused by Trypanosoma evansi in India. Trans R Soc Trop Med Hyg 2006;100:989-991. [CrossRef][ISI][Medline]
  11. Truc P, Gibson WC, Herder S. Genetic characterization of Trypanosoma evansi isolated from a patient in India. Infect Genet Evol (in press).
  12. Hirumi H, Hirumi K. Continuous cultivation of Trypanosoma brucei blood stream forms in a medium containing a low concentration of serum protein without feeder cell layers. J Parasitol 1989;75:985-989. [CrossRef][Medline]
  13. Schendel SL, Xie Z, Montal MO, Matsuyama S, Montal M, Reed JC. Channel formation by antiapoptotic protein Bcl-2. Proc Natl Acad Sci U S A 1997;94:5113-5118. [Free Full Text]

 

This Article
-Summary
- PDF
-PDA Full Text
-PowerPoint Slide Set

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited
-E-mail When Letters Appear

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved.