Human Trypanosoma evansi Infection Linked to a Lack of Apolipoprotein L-I
Benoit Vanhollebeke, Eng., Philippe Truc, Ph.D., Philippe Poelvoorde, M.Sc., Annette Pays, M.Sc., Prashant P. Joshi, M.D., Ravindra Katti, M.D., Jean G. Jannin, M.D., and Etienne Pays, Ph.D.
Humans have innate immunity against Trypanosoma brucei bruceithat is known to involve apolipoprotein L-I (APOL1). Recently,a case of T. evansi infection in a human was identified in India.We investigated whether the APOL1 pathway was involved in thisoccurrence. The serum of the infected patient was found to haveno trypanolytic activity, and the finding was linked to thelack of APOL1, which was due to frameshift mutations in bothAPOL1 alleles. Trypanolytic activity was restored by the additionof recombinant APOL1. The lack of APOL1 explained the patient'sinfection with T. evansi.
Trypanosoma evansi is a widely distributed hemoflagellate parasitethat affects domesticated mammals (e.g., horses, cattle, camels,and water buffalo). Since its adaptation to mechanical transmissionby blood-sucking insects (tabanids), the parasite has spreadbeyond its original distribution in sub-Saharan Africa and isnow also present in South America, North Africa, and large partsof Asia, including India. Normally, humans are resistant toinfection with T. evansi, as well as to infection with the relatedAfrican trypanosomes, the prototype of which is T. brucei brucei.1,2,3Human innate immunity against T. brucei brucei is due to thetrypanolytic activity of a human-specific apolipoprotein boundto high-density lipoproteins, termed apolipoprotein L-I (APOL1).4This protein contains an ionic pore-forming domain consistingof nine alpha helixes, as well as an adjacent pH-sensitive membrane-addressingdomain consisting of two alpha helixes.5 APOL1 is taken up inthe parasite by endocytosis and triggers the formation of anion-selectivepores in the lysosomal membrane, which induces the uncontrolledosmotic swelling of this compartment and subsequent cell death.5,6
The T. brucei subspecies T. brucei rhodesiense and T. bruceigambiense have acquired resistance to APOL1, which enables theseparasites to infect humans and cause sleeping sickness. In T.brucei rhodesiense, resistance to normal human serum is conferredby a single protein, termed serum resistanceassociatedprotein (SRA), which interacts strongly and specifically withAPOL1.4,7 SRA was found to provide specific resistance to T.brucei rhodesiense.7,8 The mechanism of resistance of T. bruceigambiense to APOL1 is not understood.6T. evansi is normallysensitive to normal human serum2,3; therefore, it had not beenknown to cause human disease until recently, when it was foundto have infected a human in the Maharashtra state of India.9,10The patient was an Indian cattle farmer who presented with a5-month history of fluctuating trypanosome parasitemia associatedwith febrile episodes. Findings on morphologic examination ofthe parasites, as well as serologic and molecular tests in particular the presence of typical kinetoplast-DNA minicirclesof type A identified the infecting species as T. evansi.9,11The patient was treated with suramin, which led to a completecure.10SRA was not detected in these parasites.11 We reportresults of the analysis of the trypanolytic activity in theserum of the infected person; our analysis allowed us to proposean explanation as to why he became infected.
Methods
We obtained the T. evansi reference strains Zagora 1.17 andVietnam-WH, taken from a camel in Morocco and a water buffaloin Vietnam, respectively, from the Institute of Tropical Medicine,in Antwerp, Belgium. The parasites isolated from the Indianpatient, with his consent, could not be grown in vitro or inrodents, which prevented their physiological analysis. Geneticanalyses showed that these parasites have a close relationshipwith the Vietnam-WH isolate.11
Trypanolysis assays were conducted using 2x105 trypanosomesper milliliter from the T. evansi Zagora 1.17 and Vietnam-WHstrains or the T. brucei brucei EATRO1125 strain, isolated frommice and incubated in HMI-9 medium12 containing various concentrationsof serum. After 24 hours, living trypanosomes were counted threetimes by the same person. The experiment was conducted threetimes. To identify serum components interacting with SRA, recombinantHis6-tagged SRA (10 µg) was incubated with 50 µlof serum for 4 hours at 4°C in 0.6 M sodium chloride, 0.35%CHAPS, and 0.15 M MES buffer (pH 5.8). The mixture was thenincubated for 30 minutes at 4°C with 10 µl NiNTA(nickel-charged agarose) beads (Qiagen). Bound material waseluted with 250 mM imidazole. Western blots were incubated overnightat 4°C with a 1:100 dilution of a goat polyclonal monospecificantiAPOL1 antibody (Santa Cruz Biotechnology) in 150mM sodium chloride, 0.5% (weight per volume) Tween 20, and 20mM TRIShydrochloric acid (pH 7.5) with 1% nonfat milk.The bound antibodies were detected using peroxidase-conjugatedmouse anti-goat IgG.
Genomic DNA was extracted from peripheral blood cells. The followingfive primer sets were used to amplify the APOL1 coding sequencesfrom 100 ng genomic DNA: 5'CCATCCTGGCTAACATGGTGAAACC3' and 5'GTTAGCCTCAACTAGGATACAGCGG3';5'TCTGTAATGATCAGATGGCTGCCCG3' and 5'AGGTGCCACCCTCCATTCTAAGTGC3';5'AACAAGTCCCACATCACAGCTGTCC3' and 5'AAAGTTCCCATCACCAGCAGATGGC3';5'AGCCACCACACCGAGCCAAAACTGC3' and 5'AGCACAAGAAAGAAGCTTACAGGGG3';and 5'AGGGTTAATGAACCCAGCATCCTGG3' and 5'ATGGCCCCCAAAGCTTGGAAAGAGC3'.The polymerase chain reaction (PCR) products and seven clonedmutation-containing fragments from three independent PCRs weresequenced.
Recombinant APOL1 was purified using His6-tagged APOL1 expressedfrom pET21d vector in Escherichia coli after a 4-hour inductionat 37°C with 1 mM isopropyl -D-thiogalactoside. After washing,inclusion bodies were dissolved in 6 M guanidiumhydrochloricacid and 50 mM phosphate buffer (pH 8.0) and incubated withNi-NTA beads for 16 hours at 4°C.13 All washing steps occurredat pH 8.0. After elution and dialysis against 20 mM acetic acid,the protein was more than 96% pure, as determined by sodiumdodecyl sulfatepolyacrylamide-gel electrophoresis (SDS-PAGE).The nucleotide sequence GenBank accession number for these sequenceswill be publicly available with the release of dbSNP build 127of the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov).
Results
The potential of the serum from the person with T. evansi infectionto lyse T. evansi was evaluated in vitro. Two different parasitestrains, one from Morocco and one from Vietnam, were used. Nolytic activity was observed, since the parasites had normalgrowth in this serum. Trypanolytic activity was shown in normalhuman serum after dilution by a factor of 100,000 (Figure 1).The serum from the person with T. evansi infection showed nolytic activity against T. brucei brucei (Figure 1).
Figure 1. Lack of Trypanolytic Activity in T. evansiInfected Human Serum.
From each parasite isolate, 2x105 trypanosomes per milliliter were incubated with various serum concentrations. Physiologic amounts of purified recombinant APOL1 (10 µg per milliliter) were added in some instances. After 24 hours, living trypanosomes were counted three times. Error bars represent standard deviations from three independent experiments. T. brucei brucei + SRA is a transgenic T. brucei brucei line transfected with the SRA gene of T. brucei rhodesiense.7 FCS denotes fetal-calf serum, NHS normal human serum, and TeiHS T. evansiinfected human serum.
APOL1 is the known factor in normal human serum that kills T.brucei brucei.4,5,6 This protein is not present in nonhumanserum such as fetal-calf serum, but the addition of recombinantAPOL1 is sufficient to render fetal-calf serum lytic for T.brucei brucei, except when the gene for the APOL1-neutralizingT. brucei rhodesiense protein SRA is transfected into this parasite7(Figure 1). The presence of APOL1 in the serum from the personwith T. evansi infection was analyzed by incubating Westernblots with antiAPOL1 antibodies, using normal human serumas a control. To assess the presence of APOL1, these serum sampleswere subjected to affinity chromatography on SRA, since APOL1is known to bind strongly and specifically to this protein.4As compared with normal human serum, T. evansiinfectedhuman serum appeared to be largely devoid of APOL1 (by a factorof at least 125, as determined by densitometry) (Figure 2).A band weakly detected at approximately the expected size inunfractionated T. evansiinfected human serum was unlikelyto be APOL1, because it did not bind to SRA and was also foundin the SRA-unbound fraction of normal human serum (Figure 2A).
Figure 2. Lack of APOL1 in T. evansiInfected Human Serum.
Normal human serum (NHS) and T. evansiinfected human serum (TeiHS) were subjected to affinity chromatography on serum resistanceassociated protein (SRA), and equivalent volumes of total serum, unbound fraction, and bound fraction were analyzed by Western blotting with the use of antiAPOL1 antibodies (Panel A). Bound fractions of the indicated serum volumes were subjected to the same Western blot analysis (Panel B).
To determine the reason for the lack of APOL1 in serum fromthe person with T. evansi infection, DNA was extracted fromhis blood cells and PCR analysis was conducted with the useof five pairs of oligonucleotide primers that allowed the amplificationof the complete APOL1 coding sequence. Two different mutationswere detected with equal frequency in each of three independentPCR assays and are thus likely to characterize each allele (Figure 3A).For one allele, the absence of two bases resulted in a frameshiftmutation from residue 142, leading to a premature stop at position149, located in helix 5 of the pore-forming domain (Figure 3A and 3B).In the other allele, the absence of a single base resulted ina frameshift mutation from residue 266, located between thetwo alpha helixes of the membrane-addressing domain, leadingto a premature stop at position 268 (Figure 3A and 3B). In bothcases, the putative truncated proteins are predicted to be unableto trigger trypanolysis, because the simultaneous presence ofintact pore-forming and membrane-addressing domains is requiredfor this activity.5
Figure 3. Frameshift Mutations in the APOL1 Gene of the T. evansiInfected Patient.
Panel A shows nucleotide and amino acid sequences at the frameshift mutations. The nucleotides deleted from the wild-type sequence are boxed, and the shifted mutant frames are in boldface type. Panel B shows the predicted amino acid sequences of wild-type and mutant APOL1 alleles. Red sequences represent the pore-forming domains and blue sequences the membrane-addressing domains of APOL1. The alpha helixes of each domain are underlined, and those of the pore-forming domain are numbered from 2 to 10 on the basis of sequence alignment with colicin A.5
The addition of normal levels of purified recombinant APOL1to serum from the person with T. evansi infection was sufficientto restore its lytic potential (Figure 1). Therefore, the lackof APOL1 is responsible for the lack of trypanolytic activityof this serum.
Discussion
This case of human infection with T. evansi could be due eitherto acquired resistance to normal human serum by the parasiteor to deficient trypanolytic activity of the host. T. evansiinfectedhuman serum did not affect the two T. evansi strains (from Moroccoand from Vietnam) that we tested. This serum was remarkablydevoid of APOL1, a protein identified as a trypanolytic factorof normal human serum in the case of T. brucei brucei.4,5,6The lack of APOL1 was due to the combination of two differentframeshift mutations, one in each allele, which led to prematuretranslational stops. The inability of T. evansiinfectedhuman serum to kill T. evansi was probably due to this lackof APOL1, for the following reasons: this serum did not lyseT. brucei brucei, APOL1 is known to be the lytic factor of theseparasites in normal human serum, and the addition of recombinantAPOL1 restored the lytic potential of this serum.4,5,6 Thesedata show that this case of T. evansi infection in a human isprobably due to mutations in the APOL1 gene.
Supported by the Belgian Fonds National de la Recherche Scientifique(FNRS), the Special Program for Research and Training in TropicalDiseases (cosponsored by the United Nations Development Program,the World Bank, and the World Health Organization), and theInteruniversity Attraction Poles Program (managed by the BelgianScience Policy).
No potential conflict of interest relevant to this article wasreported.
Source Information
From the Laboratory of Molecular Parasitology, Institut de Biologie et de Médecine Moléculaires, Université Libre de Bruxelles, Gosselies, Belgium (B.V., P.P., A.P., E.P.); the Institut de Recherche pour le Développement, Unité de Recherche 117 Trypanosomoses Africaines, Montpellier, France (P.T.); the Department of Medicine, Government Medical College, Nagpur, India (P.P.J.); the Directorate of Health Services, Mumbai, India (R.K.); and Communicable Diseases Control, Prevention and Eradication, World Health Organization, Geneva (J.G.J.).
Address reprint requests to Dr. Pays at the Laboratory of Molecular Parasitology, IBMM, Université Libre de Bruxelles, 12 rue des Professeurs Jeener et Brachet, B-6041 Gosselies, Belgium, or at epays{at}ulb.ac.be.
References
Laveran A, Mesnil F. Trypanosomes et trypanosomiases. Paris: Masson et Cie, 1912:379.
Hawking F. The resistance of Trypanosoma congolense, T. vivax and T. evansi to human plasma. Trans R Soc Trop Med Hyg 1978;72:405-407. [CrossRef][ISI][Medline]
Juyal PD, Singla LD, Saxena HM. In vivo activity of human serum against T. evansi infection in Swiss albino mice. J Parasitic Dis India 1998;22:67-8.
Vanhamme L, Paturiaux-Hanocq F, Poelvoorde P, et al. Apolipoprotein L-I is the trypanosome lytic factor of human serum. Nature 2003;422:83-87. [CrossRef][Medline]
Pérez-Morga D, Vanhollebeke B, Paturiaux-Hanocq F, et al. Apolipoprotein L-I promotes trypanosome lysis by forming pores in lysosomal membranes. Science 2005;309:469-472. [Free Full Text]
Pays E, Vanhollebeke B, Vanhamme L, Paturiaux-Hanocq F, Nolan DP, Pérez-Morga D. The trypanolytic factor of human serum. Nat Rev Microbiol 2006;4:477-486. [CrossRef][ISI][Medline]
Xong HV, Vanhamme L, Chamekh M, et al. A VSG expression site-associated gene confers resistance to human serum in Trypanosoma rhodesiense. Cell 1998;95:839-846. [CrossRef][ISI][Medline]
Gibson WC. The SRA gene: the key to understanding the nature of Trypanosoma brucei rhodesiense. Parasitology 2005;131:143-150. [Medline]
Joshi PP, Shegokar VR, Powar RM, et al. Human trypanosomiasis caused by Trypanosoma evansi in India: the first case report. Am J Trop Med Hyg 2005;73:491-495. [Free Full Text]
Joshi PP, Chaudhari A, Shegokar VR, et al. Treatment and follow-up of the first case of human trypanosomiasis caused by Trypanosoma evansi in India. Trans R Soc Trop Med Hyg 2006;100:989-991. [CrossRef][ISI][Medline]
Truc P, Gibson WC, Herder S. Genetic characterization of Trypanosoma evansi isolated from a patient in India. Infect Genet Evol (in press).
Hirumi H, Hirumi K. Continuous cultivation of Trypanosoma brucei blood stream forms in a medium containing a low concentration of serum protein without feeder cell layers. J Parasitol 1989;75:985-989. [CrossRef][Medline]
Schendel SL, Xie Z, Montal MO, Matsuyama S, Montal M, Reed JC. Channel formation by antiapoptotic protein Bcl-2. Proc Natl Acad Sci U S A 1997;94:5113-5118. [Free Full Text]
Molina-Portela, M. P., Samanovic, M., Raper, J.
(2008). Distinct roles of apolipoprotein components within the trypanosome lytic factor complex revealed in a novel transgenic mouse model. J. Exp. Med.
205: 1721-1728
[Abstract][Full Text]
Desquesnes, M., Bossard, G., Patrel, D., Herder, S., Patout, O., Lepetitcolin, E., Thevenon, S., Berthier, D., Pavlovic, D., Brugidou, R., Jacquiet, P., Schelcher, F., Faye, B., Touratier, L., Cuny, G.
(2008). First outbreak of Trypanosoma evansi in camels in metropolitan France. Vet Rec.
162: 750-752
[Abstract][Full Text]
Lai, D.-H., Hashimi, H., Lun, Z.-R., Ayala, F. J., Lukes, J.
(2008). Adaptations of Trypanosoma brucei to gradual loss of kinetoplast DNA: Trypanosoma equiperdum and Trypanosoma evansi are petite mutants of T. brucei. Proc. Natl. Acad. Sci. USA
105: 1999-2004
[Abstract][Full Text]
Vanhollebeke, B., Nielsen, M. J., Watanabe, Y., Truc, P., Vanhamme, L., Nakajima, K., Moestrup, S. K., Pays, E.
(2007). Distinct roles of haptoglobin-related protein and apolipoprotein L-I in trypanolysis by human serum. Proc. Natl. Acad. Sci. USA
104: 4118-4123
[Abstract][Full Text]