The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
Brief Report
PreviousPrevious
Volume 359:593-602 August 7, 2008 Number 6
NextNext

HHV-6A in Syncytial Giant-Cell Hepatitis
Leonardo Potenza, M.D., Mario Luppi, M.D., Ph.D., Patrizia Barozzi, Ph.D., Giulio Rossi, M.D., Stefania Cocchi, M.D., Mauro Codeluppi, M.D., Monica Pecorari, M.D., Michele Masetti, M.D., Fabrizio Di Benedetto, M.D., Ph.D., William Gennari, B.Sc., Marinella Portolani, M.D., Giorgio Enrico Gerunda, M.D., Tiziana Lazzarotto, Ph.D., Maria Paola Landini, M.D., Thomas F. Schulz, M.D., Giuseppe Torelli, M.D., and Giovanni Guaraldi, M.D.

 

This Article
-Summary
- PDF
-PDA Full Text
-PowerPoint Slide Set

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited
-E-mail When Letters Appear

More Information
-PubMed Citation
SUMMARY

Syncytial giant-cell hepatitis is a rare but severe form of hepatitis that is associated with autoimmune diseases, drug reactions, and viral infections. We used serologic, molecular, and immunohistochemical methods to search for an infectious cause in a case of syncytial giant-cell hepatitis that developed in a liver-transplant recipient who had latent infection with variant B of human herpesvirus 6 (HHV-6B) and who had received the organ from a donor with variant A latent infection (HHV-6A). At the onset of the disease, the detection of HHV-6A (but not HHV-6B) DNA in plasma, in affected liver tissue, and in single micromanipulated syncytial giant cells with the use of two different polymerase-chain-reaction (PCR) assays indicated the presence of active HHV-6A infection in the patient. Expression of the HHV-6A–specific early protein, p41/38, but not of the HHV-6B–specific late protein, p101, was demonstrated only in liver syncytial giant cells in the absence of other infectious pathogens. The same markers of HHV-6A active infection were documented in serial follow-up samples from the patient and disappeared only at the resolution of syncytial giant-cell hepatitis. Neither HHV-6B DNA nor late protein was identified in the same follow-up samples from the patient. Thus, HHV-6A may be a cause of syncytial giant-cell hepatitis.


Syncytial giant-cell hepatitis is an uncommon form of hepatitis in the post-infantile period, clinically characterized by a severe, often fatal course that is associated with autoimmune diseases, drug reactions, and viral infections.1,2,3,4 Although a potential paramyxoviral cause has been suggested, no direct evidence of the putative infectious agent has yet been found on electron microscopy.1,2,3,4 Medical therapies, namely immunosuppressive drugs and antiviral treatments, have been tried with limited success, and orthotopic liver transplantation is often the only therapeutic option, although the disease may recur after transplantation.1,2,3,4,5

HHV-6, a ubiquitous beta-herpesvirus with two distinct variants, A and B, is the causative agent of sixth disease of childhood.6,7 After primary infection, HHV-6 establishes a latent state in the host, but it may reactivate and cause illness in immunocompromised patients.6,8 HHV-6 reactivation occurs in 40 to 50% of recipients of bone marrow and solid-organ transplants, mostly due to variant B, with variant A accounting for less than 2 to 3% of infections. Active infection (or reactivation) has been associated with bone marrow suppression, encephalitis, pneumonitis, and hepatitis.8 Occasionally, HHV-6 infection may result from primary infection as a consequence of virus transmission from the donor to the recipient through a transplanted organ.6,8 We describe a case of severe post-transplantation syncytial giant-cell hepatitis in an adult patient who was latently infected with HHV-6B.

Case Report

A 43-year-old man with Caroli's disease underwent orthotopic liver transplantation because of recurrent cholangitis. Serologic analyses that were performed before transplantation were positive for cytomegalovirus (CMV), Epstein–Barr virus (EBV), human herpes simplex viruses 1 and 2 (HSV-1 and HSV-2), varicella–zoster virus (VZV), and parvovirus B19 and were negative for human immunodeficiency virus (HIV) and hepatitis virus types A, B, and C. Serologic analyses of the donor were positive for CMV and EBV and negative for HIV and hepatitis virus types A, B, and C.

Induction immunosuppression consisted of a triple-drug schedule with tacrolimus, corticosteroids, and mycophenolate mofetil. Maintenance immunosuppression consisted of tacrolimus with trough blood levels of 10 to 15 ng per milliliter after postoperative day 2. On day 10, fever developed. The physical examination was unremarkable. A full blood count showed mild neutrophil leukocytosis, and liver-function tests revealed elevated levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) (Figure 1).

Figure 1
View larger version (24K):
[in this window]
[in a new window]
Get Slide
 
Figure 1. Clinical Course of the Patient.

Shown are changes in the patient's liver enzymes, HHV-6 serum antibody titers, plasma DNA, and viral load, as seen in liver-biopsy specimens during 354 days of follow-up after liver transplantation. AGR denotes acute graft rejection, ALT alanine aminotransferase, AP alkaline phosphatases, AST aspartate aminotransferase, {gamma}-GT {gamma}-glutamyltransferase, Neg negative, OKT3 muromonab-CD3, OLT orthotopic liver transplantation, and SGCH syncytial giant-cell hepatitis. The striped portion of the bar representing ganciclovir therapy indicates intravenous administration, and the solid portion of the bar indicates oral administration. ALT and AST are measured in units per liter and bilirubin in milligrams per deciliter.

 
Microbiologic cultures and molecular examination of blood, urine, and stool were normal. PCR assays of body fluids were negative for hepatitis viruses B and C, CMV, EBV, HSV-1, HSV-2, VZV, parvovirus B19, human herpesviruses 7 and 8 (HHV-7 and HHV-8), adenovirus, and polyomaviruses (JC and BK). Abdominal ultrasonography showed mild splenomegaly. Empiric antibiotic and antifungal treatments were started, and a liver biopsy was performed. Histologic examination revealed signs of moderate acute graft rejection, according to the Banff grading score.9

High-dose corticosteroid pulse treatment, followed by the administration of the monoclonal antibody muromonab-CD3 (OKT3), was undertaken for 5 days. Despite gradual improvement in AST and ALT levels, the cholestatic indexes increased and fever persisted (Figure 1). On day 13, the results of another liver biopsy showed improvement in the acute graft rejection (indeterminate, according to Banff grading) and the appearance of few giant-cell hepatocytes. On day 16, microbiologic and molecular examinations again were normal, including for the aforementioned viruses, except for HHV-6, which was positive on PCR. Intravenous ganciclovir was started at a dose of 5 mg per kilogram of body weight twice daily. On day 18, the results of a third liver biopsy showed complete resolution of acute graft rejection and diffuse giant transformation of hepatocytes, consistent with syncytial giant-cell hepatitis (Figure 2A). On day 34, after continued ganciclovir therapy, the fever resolved, but the cholestatic indexes remained elevated, and the full blood count disclosed anemia (hemoglobin, 8.5 g per deciliter), with an elevated reticulocyte count (40%) and lactate dehydrogenase level (2140 IU per liter), thrombocytopenia (platelet count, 45,000 per cubic millimeter), and mild renal failure (creatinine level, 2.1 mg per deciliter [186 µmol per liter]). The Coombs test and analyses for antiplatelet antibodies were negative. HHV-6 viremia was still detectable in plasma, in the absence of all the other pathogens, either by culture or molecular examination, and the results of a new liver biopsy showed the persistence of syncytial giant-cell hepatitis. A diagnosis of thrombotic microangiopathy was suspected.

Figure 2
View larger version (125K):
[in this window]
[in a new window]
Get Slide
 
Figure 2. Histologic and Immunohistochemical Findings in Biopsy Specimens from the Patient and a Control Subject.

In Panel A, several syncytial giant cells (arrows) are clearly visible in a liver-biopsy specimen from the patient that was obtained on postoperative day 18 (hematoxylin and eosin). On contiguous sections from the same biopsy specimen, immunostaining with mouse IgG1 monoclonal antibody is positive for HHV-6A only in the syncytial giant cells with a cytoplasmic pattern (Panel B, reddish areas), whereas such immunostaining is negative for herpes simplex virus type 1 (Panel C, arrows). In Panel D, no syncytial giant cells are detectable in a liver-biopsy specimen obtained from the patient after 1 year of antiviral treatment, and immunostaining with mouse IgG1 monoclonal antibody is negative for HHV-6A. In Panel E, in contiguous sections from the liver-biopsy specimen obtained on postoperative day 18, immunostaining with mouse IgG1 monoclonal antibody is negative for HHV-6B (arrows). In Panel F, in a specimen obtained during lymph-node biopsy from a control subject with lymphadenopathy related to HHV-6B infection, immunostaining with mouse IgG1 monoclonal antibody is positive for HHV-6B in follicular dendritic cells of a reactive germinal center (reddish color).

 
Another course of corticosteroid pulse treatment was administered. After 2 weeks, the full blood count normalized, and the cholestatic indexes markedly improved. Corticosteroids (i.e., prednisone) were progressively reduced to 5 mg per day, and on day 56, ganciclovir was switched to an oral formulation at a dose of 1 g three times daily. After 2 months, the patient was asymptomatic, plasma HHV-6 was still detectable on PCR assay, and a liver-biopsy specimen showed mild signs of syncytial giant-cell hepatitis. HHV-6 became undetectable in plasma after 4 months. At 1 year, the results of liver biopsy were normal, and oral ganciclovir was reduced to 250 mg twice daily for an additional year.

Methods

Serologic Studies

The serologic assays that were performed have been described previously.10 The sources of virus antigens were the GS strain (variant A) of HHV-6 passaged in the T-cell acute lymphoblastic leukemia–derived cell line, HSB-2, and the Z29 strain (variant B) passaged in Molt3 cells. The serologic results were evaluated with sample identities masked.

Histopathological and Immunohistochemical Studies

Formalin-fixed and paraffin-embedded liver specimens were obtained from fine-needle biopsy from the patient on postoperative days 11, 13, 18, 40, and 44 and at 3 and 6 months and 1 year after transplantation. The specimens were stained with hematoxylin and eosin for routine histologic studies.

In situ hybridization and immunohistochemical analyses with standard immunoperoxidase-staining procedures were performed, as described previously,11,12 with the use of a mouse monoclonal antibody against the early protein (p41/38) of HHV-6A (Advanced Biotechnologies); a mouse monoclonal antibody against the late protein (p101K) of HHV-6B (Chemicon International); monoclonal or polyclonal antibodies against HSV-1 and HSV-2 (code numbers, B0114 and B0116, respectively) at a dilution of 1:200, against CMV (clone CCH2) at a dilution of 1:50, against EBV (EBER, PNA probe/Fluorescein), and against human papillomavirus (clone K1H8) at a dilution of 1:100 (all from Dakopatts); and monoclonal antibody against adenovirus (clone 20/11) at a dilution of 1:100 (Chemicon).11,12 Both HHV-6 monoclonal antibodies were applied for 1 hour at room temperature (dilution 1:200) after antigen retrieval in a microwavable pressure cooker (Nordic Ware) containing 1.5 liters of 10 mM citrate buffer (pH 6.0) with 0.1% Tween 20 and were microwaved (Model R4A80, Sharp Electronics) for 8 minutes at 700 W. They were visualized with the use of EnvisionPlus (Dako), according to the manufacturer's instructions.11,12

Molecular Studies and Micromanipulation and Single-Cell PCR

Molecular studies and micromanipulation and single-cell PCR were performed as described previously.13,14 A quantitative real-time PCR assay was performed with the use of a commercially available diagnostic kit (Nanogen Advanced Diagnostics) in order to quantify the HHV-6 load in the donor's peripheral-blood leukocytes, as well as in the five available liver-biopsy specimens from the patient. Results by quantitative PCR were confirmed by an independent laboratory. The presence of DNA from herpesvirus (EBV, CMV, HHV-6, HHV-8, HHV-7, HSV-1, HSV-2, and VZV), adenovirus, and polyomavirus (either JC or BK) was confirmed in micromanipulated single giant-cell hepatocytes by PCR analysis with the use of protocols that have been described previously.13,14,15,16,17 Results were confirmed by an independent laboratory in a double-blinded manner.

To obtain efficient PCR amplification of HHV-6 DNA in single cells from formalin-fixed, paraffin-embedded tissues, two new primers were designed to amplify a 306-bp fragment (left primer, 5'ATCACGATCGGCGTGCTAT3'; right primer, 5'ATGGATTTCCGTGGAAGAAA3'). The number of cycles was 35 at an annealing temperature of 55°C. The PCR conditions were the same as those reported previously.13

The characterization of HHV-6 variants was performed by restriction analysis of the HHV-6 PCR product13 and also by a highly sensitive primer-specific PCR assay, as described previously.18 Moreover, in order to obtain efficient PCR amplification of HHV-6 in single cells from formalin-fixed, paraffin-embedded tissues with the primer-specific PCR assay, the probe, as originally described by Boutolleau et al.,18 was used as an internal primer for a second round of PCR to amplify a 113-bp fragment.

Results

Serologic Studies

On the day of transplantation, serum from the donor was negative for IgM and positive for IgG antibodies against HHV-6 at a titer of 1:80, and serum from the patient was negative for IgM and positive for IgG antibodies against HHV-6 at a titer of 1:40 (Figure 1). After urea treatment of the samples, the HHV-6 IgG titers, from both the donor and the patient, were reduced by a factor of 4 or less (log2 reduction, ≤2), indicative of high-avidity antibodies and consistent with the HHV-6 seropositive status.

On postoperative day 16, the patient had both a positive IgM titer (1:40) and a rising titer of IgG antibodies against HHV-6. The avidity of the latter was low, as shown by the reduction in the IgG titer by a factor of 8 after washing with urea (from 1:2560 to 1:320; log2 reduction, 3). A reduction in the antibody titer by a factor of 8 after urea treatment is mild and not conclusive for the presence of low-avidity IgG in our patient, although a similar finding in a transplant recipient was described previously.10 Since the serologic assay cannot discriminate between the two HHV-6 variants, we hypothesized that this borderline drop in IgG after urea treatment could be ascribed to the presence of a mixture of low-avidity IgG antibodies against HHV-6A and high-avidity IgG antibodies against HHV-6B so that this background of high-avidity antibodies would have prevented a sharper decrease in the IgG titers. These serologic findings, which suggested possible active viral infection, spurred us to investigate whether HHV-6A was the replicating virus in our patient with latent HHV-6B infection (Figure 1).

Molecular Studies

The identification of HHV-6 variants A and B in all samples from the donor and the patient was confirmed by two different assays: a primer-specific PCR assay (Figure 3)13 and a restriction analysis of the HHV-6 PCR product (Figure 4E and 4F).18 At the time of transplantation, HHV-6A (but not HHV-6B) DNA was detected in peripheral-blood leukocytes from the donor, with a viral load of 4500 genome equivalents (gEq) per microgram of DNA. At the same time, HHV-6B (but not HHV-6A) DNA was detected in peripheral-blood leukocytes from the patient on PCR (Figure 3A). On PCR assay, HHV-6A DNA was detected in the patient's plasma at a relatively low titer (20 to 40 genomes per milliliter), starting on postoperative day 16 and persisting at similar levels until the sixth month after transplantation, whereas HHV-6B DNA was never detected in the same plasma samples (Figure 1).

Figure 3
View larger version (34K):
[in this window]
[in a new window]
Get Slide
 
Figure 3. Detection of HHV-6 and Y Chromosome by Primer-Specific Polymerase Chain Reaction (PCR).

Panel A shows PCR detection of HHV-6 in peripheral-blood leukocytes of both the donor and the patient at the time of transplantation (T0) and in the patient's liver-biopsy specimens on postoperative days 18, 40, and 354 with primers specific for variant A (upper panel) and variant B (lower panel). The PCR product of the expected length (113 bp) with variant-A–specific primers was amplified in DNA from the donor's peripheral-blood leukocytes and the patient's liver-biopsy specimens containing syncytial giant cells but not in DNA from the patient's peripheral-blood leukocytes at the time of transplantation or in the patient's liver-biopsy specimen after the resolution of syncytial giant-cell hepatitis (upper panel). The PCR product of the same length, but with variant-B–specific primers, was amplified only in the recipient's DNA at the time of transplantation (lower panel). Samples from positive control subjects are represented by DNA from the GS strain of HHV-6A (GS/A), passaged in an HSB-2 cell line, and from the Z29 strain of HHV-6B (Z29/B), passaged in a Molt3 cell line. MKIX denotes Marker IX, and NC negative control. Panel B shows PCR detection of HHV-6 in giant cells isolated from the recipient's liver-biopsy specimen on day 18, with primers specific for variant A (upper panel) and variant B (lower panel). The PCR product of the expected length (113 bp) with variant-A–specific primers was amplified in 4 of 10 syncytial giant cells (upper panel; lanes 1, 7, 8, and 10), whereas no PCR product with variant-B–specific primers was detected in any of the syncytial giant cells tested (lower panel). Panel C shows PCR detection of HHV-6 in normal hepatocytes from the patient's liver-biopsy specimen on day 18, with primers specific for variant A (upper panel) and variant B (lower panel). No PCR product with either variant A or variant B was detected in any of the normal hepatocytes tested. Panel D shows double PCR detection of HHV-6 with primers specific for variant A and Y-chromosome DNA in representative giant-cell hepatocytes (upper panel; lane 10) and normal hepatocytes (lower panel) from the patient's liver-biopsy specimen on day 18. Two amplified products of the expected lengths of 190 bp (Y-chromosome DNA) and 113 bp (HHV-6 variant A) were simultaneously detected in 1 of 10 single giant-cell hepatocytes (upper panel; lane 10). HHV-6 variant A was detected in only three other single giant-cell hepatocytes (upper panel; lanes 2, 7, and 8), and Y-chromosome DNA was detected in only one of eight single normal hepatocytes (lower panel; lane 6).

 
Figure 4
View larger version (92K):
[in this window]
[in a new window]
Get Slide
 
Figure 4. Micromanipulation of Syncytial Giant Cells and Polymerase-Chain-Reaction (PCR) Detection of HHV-6A.

A single hepatocyte was isolated from a liver-biopsy specimen from the patient (hematoxylin and eosin), which is shown before the isolation of the hepatocyte (Panel A; pointer of probe shows as a line on the image) and after isolation (Panel B). A single syncytial giant cell from the patient is isolated without damage to surrounding cells (Panel C), leaving an empty space (Panel D). Panel E shows the results of PCR detection of HHV-6 in five isolated syncytial giant cells from the patient. The PCR product of expected length (306 bp) was amplified in two of five syncytial giant cells. Positive controls are represented by DNA from the GS strain of HHV-6A (GS/A), passaged in an HSB-2 cell line, and from the Z29 strain of HHV-6B (Z29/B), passaged in a Molt3 cell line. In Panel F, digestion (Dig) with a specific restriction enzyme, HindIII, shows a band of 184 bp and one of 122 bp, indicating the presence of HHV-6B in Molt3 cells, whereas only one band of 306 bp, indicating the presence of HHV-6A, was detected in undigested (Undig) DNA from an HSB-2 cell line and in Sample 5 from the patient. MKIX denotes Marker IX, and NC negative control.

 
PCR that was performed on formalin-fixed, paraffin-embedded liver sections showed HHV-6A (but not HHV-6B) DNA on postoperative day 18, concomitant with the onset of clinical symptoms and the appearance of the histologic signs of syncytial giant-cell hepatitis, as well as on all subsequent samples except for the last, which was collected 1 year after transplantation, concomitant with the histologic resolution of syncytial giant-cell hepatitis (Figure 3A). The following viral loads (per microgram of DNA) were detected in the patient's paraffin-embedded liver-biopsy samples with histologic signs of syncytial giant-cell hepatitis: day 18, 44,000 gEq; day 40, 800 gEq; day 44, 700 gEq; and day 109, 700 gEq. A viral load of 10 gEq per microgram or less of DNA was detected in a liver-biopsy specimen after the resolution of syncytial giant-cell hepatitis on postoperative day 354 (Figure 1).

Single-cell PCR that was performed on micromanipulated giant-cell hepatocytes from the liver-biopsy specimen on day 18 confirmed the presence of HHV-6A DNA, at an average level of 500 to 850 genomes per cell, but not HHV-6B or other viruses mentioned above. HHV-6A DNA was found only in giant-cell hepatocytes with an amplification efficiency ranging from 40 to 50%14 (Figure 3B and Figure 4A through 4F). HHV-6A DNA was not detected in any of the 90 to 100 normal uninuclear hepatocytes, whereas Y-chromosome DNA could be amplified in 10 to 20% of the same cells (Figure 3C and 3D).

Immunohistochemical Studies

Immunohistochemical analysis of the liver-biopsy specimen obtained on day 18 with the use of p41/38 monoclonal antibody against HHV-6A highlighted cytoplasmic reactivity only in giant-cell hepatocytes, confirming their productive infection by HHV-6A (Figure 2B). The result of such analysis was negative with antibodies against the other viruses (Figure 2C). The same analysis for HHV-6A had negative results on a liver-biopsy sample without syncytial giant-cell hepatitis, collected 1 year after transplantation (Figure 2D). Immunohistochemical analysis with the HHV-6B p101K monoclonal antibody on a liver-biopsy specimen obtained on day 18 was negative (Figure 2E). Such analysis showed intense staining of follicular dendritic cells of a reactive germinal center in a patient with HHV-6–related lymphadenopathy, who was tested as a positive control subject and was found to have HHV-6B DNA11,12 (Figure 2F).

Discussion

In this patient, active HHV-6 infection was manifested as syncytial giant-cell hepatitis. These findings implicate HHV-6 as a possible new cause of this disease. In most cases, syncytial giant-cell hepatitis that is caused by an infectious agent has been related to a paramyxoviral source, as determined either by the finding of structures resembling nucleocapsids of paramyxoviruses in hepatocytes or by the theory that the fusion of cells to form syncytial giant cells is a pathologic feature of paramyxovirus infection.1,2,3,4,5

A possible relationship between HHV-6 and syncytial giant-cell hepatitis has been suggested previously on the basis of serologic positivity to HHV-6 in a single patient, in whom both an acute drug reaction and an autoimmune disease might have been other causative factors.19 The demonstration of HHV-6A active infection by several methods in plasma, liver tissue, and single giant-cell hepatocytes, which coincided with the onset of the patient's symptoms and histologic diagnosis, provides strong evidence that HHV-6A had a pathogenic role in this case. Extensive and repeated microbiologic testing during the entire course of the disease did not identify any other potential cause. Of interest, HHV-6 has been reported to induce cell–cell fusion in lymphocytes and epithelial cells both in vitro and in vivo in a manner similar to that of paramyxoviruses.20,21,22

We have also documented the transmission of HHV-6A from a liver donor to a recipient with latent HHV-6B infection by showing the presence of either HHV-6A DNA or antigen in plasma and affected liver tissue from the recipient after transplantation. It has been reported that the detection of HHV-6 DNA in plasma, even at low titers, is correlated with active viral replication in immunosuppressed patients.23,24 HHV-6 chromosomal integration may occur in vivo, either in patients with various diseases or in healthy subjects, and is associated with the persistence of a high viral load in infected cells.6,25 The viral load in a sample of peripheral-blood leukocytes from the donor at the time of transplantation was elevated but not at a level typically seen with HHV-6 chromosomal integration.25

Of note, it has been reported that HHV-6 is frequently reactivated in critically ill patients as a result of stress-related mechanisms, without affecting the severity of disease.26 It remains to be established whether such a reactivation is critical to the viral transmission and whether it could enhance pathogenicity in organ recipients. Furthermore, the progressive decrease in the viral load in serial liver-biopsy and plasma samples from the patient makes it unlikely that integrated HHV-6 was transmitted through liver transplantation and stably retained in the recipient's liver. It is also unlikely that HHV-6 DNA that was detected in the patient's plasma was simply the result of the shedding of stably infected cells. On the other hand, the absence of HHV-6B DNA and antigen in plasma and affected liver tissue in a patient with latent HHV-6B infection strongly suggests that HHV-6B did not have a pathogenic role.

These findings also raise issues about the immune response to the two HHV-6 variants and provide further arguments in support of systematic virologic screening of organ donors. Although HHV-6A and HHV-6B are supposed to stimulate cross-reactive T-cell responses because they share more than 88% sequence homology,27,28 it has been reported that at least 7% of the T-cell clones that are reactive to HHV-6 show specific and distinct patterns of proliferation either to variant A or variant B in vitro.29 The HHV-6A active infection in our patient suggests that the immune response that was mounted against HHV-6B may not have been protective against HHV-6A. Thus, more extensive screening of organ donors, on the basis of a wider panel of tests for both variants, may specifically address the infectious risks of the recipients and have consequences in designing prophylactic or preemptive therapeutic strategies, as in the case of CMV.8 In our patient, we continued ganciclovir for a prolonged time, because a few cases of syncytial giant-cell hepatitis were reported to have resolved with prolonged courses of ribavirin.30,31 It is unclear which factor — the use of antiviral therapy or the patient's recovery of immune function — led to the resolution of disease in this patient over several months.32,33 In conclusion, HHV-6 should be included among the possible causes of syncytial giant-cell hepatitis, at least in liver-transplant recipients.

Supported by grants from the Italian Ministry for Education, Universities, and Research (to Dr. Torelli), the Associazione Italiana per la Ricerca sul Cancro (to Dr. Luppi), the European Commission's Sixth FrameWork Programme, INCA project (2005-018704) (to Drs. Luppi and Schulz), the Associazione Italiana Lotta alle Leucemie, Linfoma e Mieloma, Modena Omlus (to Dr. Potenza), and the Programma di Ricerca Regione Università 2007–2009 (to Dr. Torelli).

No potential conflict of interest relevant to this article was reported.

We thank Claudio Cermelli and Gianandrea Pasquinelli for their technical advice and Alberto Bagni and Antonio Daniele Pinna for their clinical follow-up of the patient.


Source Information

From the Department of Oncology and Hematology (L.P., M.L., P.B., G.T.), the Integrated Department of Diagnostic and Laboratory Services and Legal Medicine (G.R., M. Pecorari, W.G., M. Portolani), the Department of Internal Medicine and Medical Specialties (S.C., M.C., G.G.), and the Liver and Multivisceral Transplant Center (M.M., F.D.B., G.E.G.) — all at the University of Modena and Reggio Emilia, Azienda Ospedaliera Policlinico, Modena; and the Department of Clinical and Experimental Medicine, University of Bologna, and St. Orsola Malpighi General Hospital, Bologna (T.L., M.P.L.) — all in Italy; and the Department of Virology, Hannover Medical School, Hannover, Germany (T.F.S.).

Drs. Potenza, Luppi, and Barozzi contributed equally to this article.

Address reprint requests to Dr. Luppi at the Department of Oncology and Hematology, University of Modena and Reggio Emilia, Azienda Ospedaliera Policlinico, Via del Pozzo 71, 41100 Modena, Italy, or at mario.luppi{at}unimore.it.

References

  1. Phillips MJ, Blendis LM, Poucell S, et al. Syncytial giant-cell hepatitits: sporadic hepatitis with distinctive pathologic features, a severe clinical course, and paramyxoviral features. N Engl J Med 1991;324:455-460. [Abstract]
  2. Lau JYN, Koukoulis G, Mieli-Vergani G, Portmann BC, Williams R. Syncytial giant-cell hepatitis -- a specific disease entity? J Hepatol 1992;15:216-219. [CrossRef][Web of Science][Medline]
  3. Devaney K, Goodman ZD, Ishak KG. Postinfantile giant-cell transformation in hepatitis. Hepatology 1992;16:327-333. [CrossRef][Web of Science][Medline]
  4. Fimmel CJ, Guo L, Compans RW, et al. A case of syncytial giant cell hepatitis with features of a paramyxoviral infection. Am J Gastroenterol 1998;93:1931-1937. [CrossRef][Web of Science][Medline]
  5. Pappo O, Yunis E, Jordan JA, et al. Recurrent and de novo giant cell hepatitis after orthotopic liver transplantation. Am J Surg Pathol 1994;18:804-813. [Web of Science][Medline]
  6. Maciejewski JP, Luppi M, Torelli G. Human cytomegalovirus, human herpesvirus 8, and other herpesviruses. In: Young NS, Gerson ST, High KA. Clinical hematology. St. Louis: Mosby, 2006:967-80.
  7. Zerr DM, Meier AS, Selke SS, et al. A population-based study of primary human herpesvirus 6 infection. N Engl J Med 2005;352:768-776. [Free Full Text]
  8. Ljungman P. β-Herpesvirus challenges in the transplant recipient. J Infect Dis 2002;186:Suppl 1:S99-S109. [CrossRef][Web of Science][Medline]
  9. Demetris AJ, Batts KP, Dhillon AP, et al. Banff schema for grading liver allograft rejection: an international consensus document. Hepatology 1997;25:658-663. [CrossRef][Web of Science][Medline]
  10. Ward KN, Gray JJ, Joslin ME, Sheldon MJ. Avidity of IgG antibodies to human herpesvirus-6 distinguishes primary from recurrent infection in organ transplant recipients and excludes cross-reactivity with other herpesviruses. J Med Virol 1993;39:44-49. [Web of Science][Medline]
  11. Maric I, Bryant R, Abu-Asab M, et al. Human herpesvirus-6-associated acute lymphadenitis in immunocompetent adults. Mod Pathol 2004;17:1427-1433. [CrossRef][Web of Science][Medline]
  12. Luppi M, Barozzi P, Garber R, et al. Expression of human herpesvirus-6 antigens in benign and malignant lymphoproliferative diseases. Am J Pathol 1998;153:815-823. [Free Full Text]
  13. Portolani M, Tamassia MG, Gennari W, et al. Post-mortem diagnosis of encephalitis in a 75-year-old man associated with human herpesvirus-6 variant A. J Med Virol 2005;77:244-248. [CrossRef][Web of Science][Medline]
  14. Barozzi P, Luppi M, Facchetti F, et al. Post-transplant Kaposi sarcoma originates from the seeding of donor-derived progenitors. Nat Med 2003;9:554-561. [Erratum, Nat Med 2003;9:975.] [CrossRef][Web of Science][Medline]
  15. Wang FZ, Dahl H, Linde A, Brytting M, Ehrnst A, Ljungman P. Lymphotropic herpesviruses in allogeneic bone marrow transplantation. Blood 1996;88:3615-3620. [Free Full Text]
  16. MacKenzie J, Perry J, Ford AM, Jarrett RF, Greaves M. JC and BK virus sequences are not detectable in leukaemic samples from children with common acute lymphoblastic leukaemia. Br J Cancer 1999;81:898-899. [CrossRef][Web of Science][Medline]
  17. Bültmann BD, Klingel K, Sotlar K, Bock T, Kandolf R. Parvovirus B19: a pathogen responsible for more than hematologic disorders. Virchows Arch 2003;442:8-17. [Web of Science][Medline]
  18. Boutolleau D, Duros C, Bonnafous C, et al. Identification of human herpesvirus 6 variants A and B by primer-specific real-time PCR may help to revisit their respective role in pathology. J Clin Virol 2006;35:257-263. [CrossRef][Web of Science][Medline]
  19. Kuntzen T, Friedrichs N, Fisher PH, Eis-Hubinger AM, Sauerbruch T, Spengler U. Postinfantile giant-cell hepatitis with autoimmune features following a human herpesvirus 6-induced adverse drug reaction. Eur J Gastoenterol Hepatol 2005;17:1131-4.
  20. Mori Y, Seya T, Huang HL, Akkapaiboon P, Dhepakson P, Yamanishi K. Human herpesvirus 6 variant A but not variant B induces fusion from without in a variety of human cells through a human herpesvirus 6 entry receptor, CD46. J Virol 2002;76:6750-6761. [Free Full Text]
  21. Pedersen SM, Oster B, Bundgaard B, Höllsberg P. Induction of cell-cell fusion from without by human herpevirus 6B. J Virol 2006;80:9916-9920. [Free Full Text]
  22. Randhawa PS, Jenkins FJ, Nalesnik MA, et al. Herpesvirus 6 variant A infection after heart transplantation with giant cell transformation in bile ductular and gastroduodenal epithelium. Am J Surg Pathol 1997;21:847-853. [CrossRef][Web of Science][Medline]
  23. Zerr DM, Corey L, Huang ML, Kim HW, Nguy L, Boeckh M. Clinical outcomes of human herpesvirus 6 reactivation after hematopoietic stem cell transplantation. Clin Infect Dis 2005;40:932-940. [CrossRef][Web of Science][Medline]
  24. Secchiero P, Carrigan DR, Asano Y, et al. Detection of human herpesvirus 6 in plasma of children with primary infection and immunosuppressed patients by polymerase chain reaction. J Infect Dis 1995;171:273-280. [Web of Science][Medline]
  25. Ward KN, Leong HN, Thiruchelvam AD, Atkinson CE, Clark DA. Human herpesvirus 6 DNA levels in cerebrospinal fluid due to primary infection differ from those due to chromosomal viral integration and have implications for diagnosis of encephalitis. J Clin Microbiol 2007;45:1298-1304. [Free Full Text]
  26. Razonable RR, Fanning C, Brown RA, et al. Selective reactivation of human herpesvirus 6 variant A occurs in critically ill immunocompetent hosts. J Infect Dis 2002;185:110-113. [CrossRef][Web of Science][Medline]
  27. Wang FZ, Dahl H, Ljungman P, Linde A. Lymphoproliferative responses to human herpesvirus-6 variant A and variant B in healthy adults. J Med Virol 1999;57:134-139. [CrossRef][Web of Science][Medline]
  28. De Bolle L, Naesens L, De Clercq E. Update on human herpesvirus 6 biology, clinical features, and therapy. Clin Microbiol Rev 2005;18:217-245. [Free Full Text]
  29. Yasukawa M, Yakushijin Y, Furukawa M, Fujita S. Specificity analysis of human CD4+ T-cell clones directed against human herpesvirus 6 (HHV-6), HHV-7, and human cytomegalovirus. J Virol 1993;67:6259-6264. [Free Full Text]
  30. Roberts E, Ford-Jones EL, Phillips JM. Ribavirin for syncytial giant cell hepatitis. Lancet 1993;341:640-641. [Web of Science][Medline]
  31. Moreno A, Moreno A, Pérez-Elías MJ, et al. Syncytial giant cell hepatitis in human immunodeficiency virus-infected patients with chronic hepatitits C: 2 cases and review of the literature. Hum Pathol 2006;37:1344-1349. [CrossRef][Web of Science][Medline]
  32. Razonable RR, van Cruijsen H, Brown RA, et al. Dynamics of cytomegalovirus replication during preemptive therapy with oral ganciclovir. J Infect Dis 2003;187:1801-1808. [CrossRef][Web of Science][Medline]
  33. Singh N, Bentlejewski C, Carrigan DR, Gayowski T, Knox KK, Zeevi A. Persistent lack of human herpesvirus-6 specific T-helper cell response in liver transplant recipients. Transpl Infect Dis 2002;4:59-63. [CrossRef][Medline]

 

This Article
-Summary
- PDF
-PDA Full Text
-PowerPoint Slide Set

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited
-E-mail When Letters Appear

More Information
-PubMed Citation


HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.